Open Access

Stimulation of plant growth and biocontrol by Bacillus amyloliquefaciens subsp. plantarum FZB42 engineered for improved action

Chemical and Biological Technologies in Agriculture20141:12

DOI: 10.1186/s40538-014-0012-2

Received: 6 April 2014

Accepted: 9 August 2014

Published: 20 September 2014

Abstract

During the last decade, the use of plant-root colonizing bacteria with plant growth-promoting activity has been proven as an efficient and environmental-friendly alternative to chemical pesticides and fertilizers. Biofertilizer and biocontrol formulations prepared from endospore-forming Bacillus strains are increasingly applied due to their long shelf life, which is comparable with that of agrochemicals. Today, spore suspensions from natural representatives of mainly Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus are available. However, these biofertilizers, directly prepared from environmental strains, are sometimes hampered in their action and do not fulfill in each case the expectations of the appliers (Borriss R, Bacteria in agrobiology: plant growth responses, Springer, 2011, pp. 41-76). This review will focus on several ways to improve the action of B. amyloliquefaciens subsp. plantarum FZB42T, the type strain for the group of plant-associated B. amyloliquefaciens strains. We are focusing here on genomics and genetic engineering techniques as helpful tools for developing more powerful biofertilizer and biocontrol agents.

Keywords

Plant growth promotion Bacillus amyloliquefaciens subsp. plantarum Biofertilizer Biocontrol Harpin genes

Introduction

In recent years, use of biologicals in plant protection is steadily increasing and begins to replace, in part, chemical pesticides. An increasing number of farmers are recognizing the need for other avenues for pest control that are not as damaging to the environment and the land. Henceforth, they are turning to biopesticides to prevent pest damage in a more ecological-friendly manner that includes targeted applications, lower residues, and fewer applications. According to a comprehensive study of BCC Research, global markets for biopesticides will grow from US$54.8 billion in 2013 to US$61.8 billion in 2014. This is estimated to reach US$83.7 billion by 2019, with a 5-year compound annual growth rate (CAGR) of 6.3% from 2014 through 2019 (http://www.bccresearch.com/market-research/chemicals/biopesticides-chm029e.html). Thereby, biological preparations from spore-forming Bacillus spp. are preferred, because their long-term viability facilitates the development of commercial products. Unfortunately, their success in agricultural application is still hampered by insufficient knowledge about basic mechanisms of interactions between bacilli and plants, although some progress has been made in last decade [1].

Plant-associated Bacillus amyloliquefaciens strains belonging to subsp. plantarum[2] are distinguished from other representatives of endospore-forming B. amyloliquefaciens by their ability to colonize plant rhizosphere, to stimulate plant growth, and to suppress competing phytopathogenic bacteria and fungi. Due to their biofertilizer and biocontrol properties, they are becoming increasingly important as a natural alternative to chemical pesticides and other agrochemicals. We have focused our research on B. amyloliquefaciens FZB42T[3], the type strain for B. amyloliquefaciens subsp. plantarum. Comparative genome analysis, transposon mutagenesis, and transcriptome and proteome analysis of this model organism are valuable means to evaluate its plant growth-promoting activity. A network of research activities was established in frame of national and international programs to elucidate the interaction of the beneficial bacterium with plants, plant pathogens, and the microbial community living on plant roots. The outcome of this research will contribute to the development of an efficient and environmental-friendly plant protection agent. In order to reveal the specific genomic features linked with the properties beneficial for plant growth and biocontrol, we have sequenced the whole genome of FZB42 as the first example of gram-positive plant beneficial bacteria [4].

Review

Rhizosphere bacilli

Land plants and bacteria have shared the same environment for approximately 360 to 480 million years [5]. The contact between them has developed into various dependencies on both sides. Plants and certain rhizobacteria form mutually beneficial associations mediated through an exchange of chemical metabolites [1].

Plant growth-promoting Bacilli, like FZB42, are able to propagate in the rhizosphere, the soil environment influenced by plant roots. This environment is highly competitive due to the nutrient-rich rhizodeposits consisting of a wide variety of compounds derived from sloughed off root cells and tissues, mucilages, and soluble exudates originating from intact roots [6]. However, roots respond to signals that stimulate defense responses (salicylic and jasmonic acids) by exuding a range of secondary metabolites, such as saponins, glucosinolates, hydroxamic acids, and naphthoquinones, which are inhibiting the growth of many ‘ordinary’ (not adapted to plant colonization) bacteria or fungi in this area.

The ability of FZB42 to colonize the rhizoplane is a precondition for plant growth promotion [7]. Using a GFP-tagged derivative [8], the fate of bacterial root colonization was recently studied. It ruled out that the bacterium behaves distinctly in colonizing root surfaces of different plants. In contrast to maize, FZB42 colonized preferentially root tips when colonizing Arabidopsis thaliana[9]. On duckweed, Lemna minor, FZB42 accumulated preferably along the grooves between epidermal cells of roots and in the concave spaces on ventral sides of fronds. In vitro studies performed with maize seedlings revealed that the segment within 2 to 8 cm distance from the basal site of the primary root was the most colonized region by FZB42. On the contrary, few bacterial cells could be observed within the range of 2 cm of root tip. In general, the green fluorescent FZB42 were decreasingly observed from the upper part of a root down to the root tip. Scanning electron microscopy confirmed the presence of FZB42 on root hairs, where the bacterial cells were usually associated with a wealth of presumed root exudates [10]. In lettuce (Lactuca sativa) seedlings, bacterial colonization occurred mainly on the primary roots and root hairs, as well as on root tips and adjacent border cells. Occurrence of labelled bacteria decreased towards the root tips of the lateral roots, and no colonization of the finer roots was observed [11].

Genomics and other -omics techniques are useful for dissecting interactions between FZB42 and plants

The whole genome sequence of the type strain of plant-associated B. amyloliquefaciens subsp. plantarum, FZB42T, has been determined in 2007, as the first representative of gram-positive, plant growth-promoting bacteria. Its 3,918-kb genome, containing an estimated 3,695 protein coding sequences (CDS), lacks extended phage insertions, which occur ubiquitously in the related Bacillus subtilis 168 genome. The B. amyloliquefaciens genome reveals a huge potential to produce secondary metabolites, including the polyketides bacillaene, macrolactin, and difficidin. More than 8.5% of the genome is devoted to synthesizing antibiotics and siderophores by pathways not involving ribosomes [12]. A comparison of its genomic sequence with that of the B. amyloliquefaciens-type strain DSM7T revealed significant differences in the genomic sequences of both strains [13]. The strains have in common 3,345 CDS residing in their core genomes; while 547 and 344 CDS were found to be unique in FZB42T and DSM7T, respectively. Notably, the gene clusters encoding non-ribosomal synthesis of antibacterial polyketides difficidin and macrolactin [14],[15] are absent in DSM7T. For comparison, B. subtilis 168T has a similar number of CDS in common with B. amyloliquefaciens strains DSM7T and FZB42T (3,222 and 3,182 CDS, respectively). Meanwhile, besides FZB42T, the genomes of other B. amyloliquefaciens plantarum strains have become available [16]. The core genome formed by 15 B. amyloliquefaciens plantarum genomes includes 3,151 genes, the pan-genome more than 6,000 genes, suggesting a high degree of flexibility in the genomes of such plant-associated B. amyloliquefaciens strains. Nevertheless, as has been shown in a previous study, the genomes of the plantarum subsp. are well distinguished from the non-plant-associated amyloliquefaciens subsp. [2]. In addition, except DSM7T, the genomes of three other representatives of the subsp. amyloliquefaciens have been published, enabling a comparative genome analysis of plant root-associated and free-living soil B. amyloliquefaciens strains. Fifty-four genes were identified as being unique for subspecies plantarum and did not occur in the free-living soil bacterium B. amyloliquefaciens subsp. amyloliquefaciens, e.g., gene clusters involved in the synthesis of difficidin and macrolactin and in carbon metabolism (Table 1). Genes involved in ribosomal synthesis of several bacteriocins, such as mersacidin [17], plantazolicin [18], and amylocyclicin [19], were detected in several representatives of B. amyloliquefaciens subsp. plantarum but are not part of the plantarum core genome. We conclude that most of the genes unique in subsp. plantarum are involved in plant-bacteria interactions. In order to support this idea, we have performed transposon mutagenesis and transcriptome and proteome analysis of FZB42 exposed directly to plants or plant root exudates [11],[20],[21]. Adding of root exudates up to a final concentration of 250 mg dry weight per liter of culture medium was found sufficient to cause a significant response of the FZB42 transcriptome and proteome during transient growth stage. Among the 302 genes with significantly altered expression by root exudates, 189 were annotated with known functions. The transcription of 46 genes involved in carbon and nitrogen utilization was altered in response to root exudates, with 43 of them being upregulated.
Table 1

Singletons occurring in Bacillus amyloliquefaciens subsp. plantarum (15 genomes), but not in Bacillus amyloliquefaciens subsp. amyloliquefaciens

Accession number

Description

BS gene

Identity (%)

Classa

RBAM_001770

DinB family; cl17821 YizA

BSU10800

49

6.7

RBAM_002650

GH25 muramidase YbfG

BSU02200

83

1.1

RBAM_002660

Unknown protein

  

6.7

RBAM_003280

Alpha-amylase AmyE

BSU03040

87

2.2

RBAM_003370

Putative antimicrobial peptide Lci

  

4.3

RBAM_004550

8-oxo-dGTP diphosphatase

BSU04330

60

3.1

RBAM_004640

Unknown protein

  

6.7

RBAM_005260

Proline/betaine transporter, MFS superfamily

  

1.2

RBAM_005610

Cation exporter TrkA, CzcD

BSU26640

89

1.2

RBAM_005640

4-Hydroxy-tetrahydrodipicolinate synthase

NP_389559

25

2.6

RBAM_006120

Unknown protein

NP_389102

43

6.7

RBAM_008480

Phosphoenolpyruvate synthase, PPDK_N

NP_389764

30

2.2

RBAM_010040

DNA alkylation repair enzyme, COG4335 YhaZ

BSU09810

63

3.1

RBAM_012380

Uronate isomerase (glucuronate isomerase) UxaC

BSU12300

77

2.2

RBAM_012390

Symporter, sugar (glycoside-pentoside-hexuronide) transporter

BSU12310

80

2.2

RBAM_013540

Oxidoreductase, NADB_Rossmann

BSU13770

97

6.6

RBAM_014340

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014350

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014360

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014370

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014390

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014400

Macrolactin synthesis; polyketide synthase of type I

  

4.3

RBAM_014410

Macrolactin synthesis; putative penicillin binding protein

  

4.3

RBAM_017950

2-keto-3-deoxygluconokinase KdgK

BSU22110

30

2.2

RBAM_017960

Zinc-type alcohol dehydrogenase, Zn_ADH7 YjmD

BSU12330

77

2.2

RBAM_017970

2-keto-3-deoxygluconate-6-phosphate aldolase KdgA

BSU22100

41

6.2

RBAM_017990

d-mannonate oxidoreductase, NADB_Rossmann

BSU12350

74

2.2

RBAM_018000

Negative transcriptional regulator (LacI family) KdgR

BSU22120

34

3.4

RBAM_018100

Endo-1,4-beta-glucanase, glycoside hydrolase family 5

BSU18130

93

2.2

RBAM_018230

H+/gluconate symporter and related permeases

BSU40050

81

3.4

RBAM_019040

Hypothetical protein, DUF4025

YP_054581

50

6.7

RBAM_019290

Hypothetical protein YoaQ

BSU18700

68

4.2

RBAM_020240

Isochorismatase, cystein hydrolase

BSU26760

93

6.7

RBAM_021810

Involved in biosynthesis of extracellular polysaccharides

BSU23680

65

2.2

RBAM_021880

Metalloprotein with Zn binding site YqjT

BSU23750

76

6.7

RBAM_021970

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_021980

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_021990

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_022000

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_022010

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_022030

Difficidin synthesis; modular polyketide synthase of type I

  

4.3

RBAM_022050

Difficidin synthesis; acyl-CoA synthetase

  

4.3

RBAM_022060

Probable acyl carrier protein

  

4.3

RBAM_022070

Difficidin synthesis

  

4.3

RBAM_022090

Putative transcription terminator/antiterminator, NGN KOW

BSU01010

26

3.2

RBAM_026190

Hypothetical protein YjdF

  

6.7

RBAM_028450

Isochorismatase hydrolase, cysteine hydrolase

   

RBAM_030020

Putative transcriptional regulator (LysR family), HTH_PBP2_LTTR YybE

BSU40670

31

3.4

RBAM_030030

Putative acetoacetate decarboxylase

   

RBAM_030040

Uncharacterized oxidoreductase, ApbA ApbA_C

ykpB

23

6.6

RBAM_033310

Putative endonuclease V, DNA repair enzyme

ywqL

85

 

RBAM_034390

ABC transporter permease, COG1284 (2xDUF161)

NP_388993

30

 

RBAM_037270

Cupin (JmjC) domain protein, cupin 8

   

RBAM_037280

ABC transporters with duplicated ATPase UuP

NP_388476

33

 

RBAM_037810

Hypothetical protein 2xDUF1529

  

6.7

aFunctional classes: 1.1 cellular processes/cell envelope, 1.2 cellular processes/transporters, 2.2 metabolism/carbon metabolism, 2.6 metabolism/additional metabolic pathways, 3.1 information processing/genetics, 3.2 information processing/RNA synthesis and degradation, 3.4 information processing/regulation of gene expression, 4.2 lifestyles/sporulation, 4.3 lifestyles/coping with stress, 6.2 groups of genes/membrane proteins, 6.6 groups of genes/poorly characterized/putative enzymes, 6.7 groups of genes/genes of unknown function.

A total of 12 genes encoding enzymes involved in the Embden-Meyerhof-Parnas (EMP) pathway (including pgi encoding for glucose-6-phosphate isomerase) and the TCA cycle were significantly upregulated. Nearly a quarter of the genes with altered transcription (46 out of 189) were involved in uptake or utilization of nutrients. This observation corroborated that root exudates serve as energy sources in the interaction between roots and rhizobacteria. A representative selection of genes involved in plant-bacteria interaction is compiled in Table 2.
Table 2

Genes involved in plant-bacteria interactions in FZB42

Accession

Gene

Function

Synthesis of IAA (Idris et al. [24])

RBAM_020800

trpBA

Tryptophan synthase subunits A and B, plant growth promotion

RBAM_020840

trpED

Anthranilate synthase, transferase, plant growth promotion

RBAM_035380

ysnE

Putative IAA acetyl transferase, plant growth promotion

Transposon mutagenesis (Budiharjo et al. [11])

RBAM_032640

degU

Two-component response regulator, swarming, biofilm formation, root colonization

RBAM_030060

yusV

Putative iron (III) ABC transport ATPase, biofilm formation, root colonization

RBAM_035360

nfrA

NADPH-flavin oxidoreductase, root colonization, plant growth promotion

RBAM017410

 

61 aa protein, plant growth promotion

Transcriptome, enhanced in presence of root exudate (Fan et al. [20])

RBAM_016150

fliM

Flagellar motor switch protein FliM, motility and chemotaxis

RBAM_016190

fliP

Flagellar biosynthetic protein FliP, motility and chemotaxis

RBAM_016290

cheC

Chemotaxis protein CheC, motility and chemotaxis

RBAM_032580

flgM

Negative regulator of flagellin synthesis, motility and chemotaxis

RBAM_032510

hag

Flagellin; involved in elicitation of plant basal defense, motility and chemotaxis

RBAM_027680

luxS

S-ribosylhomocysteine lyase LuxS, biofilm formation

RBAM_016860

ymcA

Control of community development, biofilm formation

RBAM_031630

epsE

Putative exopolysaccharide biosynthesis protein, biofilm formation

RBAM_001610

secY

Preprotein translocase subunit SecY, sec-dependent protein export

RBAM_001250

secE

Preprotein translocase subunit, sec-dependent protein export

RBAM_002940

tatA

sec-independent protein translocase protein TatAD

RBAM_002950

tatC

sec-independent protein translocase protein TatCD

RBAM_026150

phoP

Two-component response regulator, global regulation of the pho regulon

RBAM_008360

glvA

Maltose-6′-phosphate glucosidase GlvA, maltose metabolism

RBAM_008380

glvC

Phosphotransferase system (PTS) maltose-specific enzyme IICB

RBAM_008370

glvR

HTH-type transcriptional regulator GlvR, maltose operon

RBAM_035460

galK

Galactokinase GalK, galactose metabolism

RBAM_028430

pgi

Glucose-6-phosphate isomerase Pgi, carbon core metabolism

RBAM_006560

ydjE

Fructokinase homologue YdjE, carbon core metabolism

RBAM_026060

gapB

Glyceraldehyde-3-phosphate dehydrogenase, carbon core metabolism

RBAM_031290

pgk

Phosphoglycerate kinase, carbon core metabolism, gluconeogenesis

RBAM_031270

pgm2

2,3-Bisphosphoglycerate-independent phosphoglycerate mutase Pgm

RBAM_008330

acoL

Acetoin dehydrogenase E3 (dihydrolipoamide dehydrogenase) AcoL

RBAM_014440

pdhC

Pyruvate dehydrogenase E2 (dihydrolipoamide acetyltransferase) PdhC

RBAM_026180

citZ

Citrate synthase II CitZ, carbon core metabolism, TCA cycle

RBAM_017800

citB

Aconitate hydratase CitB, carbon core metabolism, TCA cycle

RBAM_019120

odhB

Succinyltransferase of 2-oxoglutarate dehydrogenase complex

RBAM_015920

sucC

Succinyl-CoA synthetase (beta subunit), carbon core metabolism, TCA

RBAM_025500

sdhB

Succinate dehydrogenase (iron-sulfur protein), carbon core metabolism

RBAM_026160

mdh

Malate dehydrogenase Mdh, carbon core metabolism, TCA cycle

RBAM_035770

licA

PTS lichenan-specific enzyme IIA

RBAM_035760

licH

6-Phospho-beta-glucosidase, utilization of lichenan

RBAM_036780

iolA

Methylmalonate-semialdehyde dehydrogenase, utilization of inositol

RBAM_036770

iolB

Inositol utilization protein B (IolB)

RBAM_036760

iolC

Inositol utilization protein C (IolC)

RBAM_036750

iolD

Inositol utilization protein D (IolD)

RBAM_036740

iolE

Inositol utilization protein E (IolE)

RBAM_036730

iolF

Inositol transport protein IolF

RBAM_036720

iolG

Myo-inositol 2-dehydrogenase IolG

RBAM_036700

iolI

Inositol utilization protein I (IolI)

RBAM_036800

iolS

Inositol utilization protein S (IolS)

RBAM_006650

bdhA

Acetoin reductase/butanediol dehydrogenase, synthesis of volatiles

RBAM_011430

oppA

Oligopeptide ABC transporter (binding protein) OppA

RBAM_011460

oppD

Oligopeptide ABC transporter (ATP-binding protein) OppD

RBAM_011470

oppF

Oligopeptide ABC transporter (ATP-binding protein) OppF

RBAM_015410

cysP

Sulfate permease CysP

RBAM_016930

baeE

Malonyl-CoA-[acyl-carrier protein] transacylase (AT) BaeE

RBAM_016970

baeI

Enoyl-CoA-hydratase BaeI, synthesis of bacillaene

RBAM_016990

baeL

Modular polyketide synthase BaeL, synthesis of bacillaene

RBAM_017010

baeN

Hybrid NRPS/PKS BaeN, synthesis of bacillaene

RBAM_017020

baeR

Modular polyketide synthase BaeR, synthesis of bacillaene

RBAM_022010

dfnF

Modular polyketide synthase of type I DfnF, synthesis of difficidin

RBAM_022000

dfnG

Modular polyketide synthase of type I DfnG, synthesis of difficidin

RBAM_021980

dfnI

Modular polyketide synthase of type I DfnI, synthesis of difficidin

RBAM_021970

dfnJ

Modular polyketide synthase of type I DfnJ, synthesis of difficidin

RBAM_014400

mlnH

Polyketide synthase of type I MlnH, synthesis of macrolactin

RBAM_018420

fenE

Fengycin synthetase FenE, synthesis of fengycin

RBAM_003680

srfAC

Surfactin synthetase C SrfAC, synthesis of surfactin

RBAM_003690

srfAD

Surfactin synthetase D SrfAD, synthesis of surfactin

Secretome enhanced in the presence of root exudate (Kierul, unpublished)

RBAM_032500

fliD

Flagellin HAP2; involved in elicitation of plant basal defense, motility

RBAM_032510

hag

Flagellin; involved in elicitation of plant basal defense, motility and chemotaxis

RBAM_026420

tpx

Thiol peroxidase, resistance against oxidative stress

RBAM_020470

ponA

Bifunctional glucosyltransferase/transpeptidase, membrane protein

RBAM_011380

appA

Oligopeptide ABC transporter (binding protein)

RBAM_011430

oppA

Oligopeptide ABC transporter (binding protein)

RBAM_023290

pstS

Phosphate ABC transporter (binding protein)

RBAM_022520

yqiG

NADH-dependent flavin oxidoreductase

RBAM_026160

mdh

Malate dehydrogenase Mdh, carbon core metabolism, TCA cycle

RBAM_033170

alsS

Acetolactate synthase, synthesis of 2,3-butanediol, plant growth promotion, elicitation of plant ISR

RBAM_025870

abnA

Arabinan-endo 1,5-alpha-l-arabinase, utilization of arabinan

RBAM_017540

chbA

Putative chitin-binding protein, utilization of chitin/chitosan

RBAM_018140

xynC

Endo-1,4-beta-xylanase, utilization of xylan

RBAM_035930

gmuG

Endo-beta-1,4-mannanase, utilization of glucomannan

Data were compiled from Idris et al. (2007), Fan et al. [20], Budiharjo et al. [11], and Kierul et al. (in preparation). Genes involved in plant-bacteria interactions in FZB42. The genes detected in both transcriptome and secretome analysis are in bold.

Plant growth promoting bacilli engineered for enhanced efficiency

An important feature of plant growth promoting rhizobacteria (PGPRs) is their root colonization activity [22]. After identifying genes involved in root colonization and other plant-bacteria interactions, markerless gene targeting techniques (strains without linked antibiotic resistance marker) are useful techniques in order to generate strains with enhanced rhizosphere competence. Enhanced root colonization and biocontrol activity was gained in B. amyloliquefaciens SQR9 by disruption of the global regulator abrB gene [23]. Other genes, involved in the expression of antimicrobial compounds can also be targeted. The global regulator gene degU was shown to control non-ribosomal synthesis of bacillomycin D [25] and bacilysin [26] in FZB42, for example.

Alternatively, reisolating of improved plant growth-promoting strains after being exposed to the natural environment for a distinct time interval, e.g., one vegetation period, is a promising approach [27]. Sequences of the unique restriction modification systems (RM) can serve as a kind of molecular ‘barcode’, facilitating specific strain identification in the environment. In contrast to Pseudomonas fluorescens and some other gram-negative bacteria, bacilli are known as comparable ‘weak’ colonizers of plant root surfaces, and plant growth-promoting bacilli are hardly detected later than 3 months after their application [28].

We have developed a specific method to detect FZB42 in environmental samples, previously treated with B. amyloliquefaciens (Rhizovital®, ABiTEP GmbH, Berlin, Germany), by combining specific methods of enrichment and molecular detection. Five months after its application in field trials, we took soil samples for reisolating FZB42 derivatives. We obtained colonies with the typical morphology of FZB42, after a complex enrichment procedure consisting of the following steps: (1) resuspending of 2.5-g sample material in 25 ml distilled water under shaking for 2 h, (2) boiling for 1 h, (3) 10 ml of the suspension was added to 40 ml liquid minimal medium with lactose as single carbon source for 1 to 2 days until rod-like bacteria became visible in the microscopic sample, and (4) plating of the 10-1 to 10-5 diluted samples onto lactose (0.1%) minimal agar plates with 0.1% azure dye-stained hydroxyl ethyl cellulose (AZCL HE). Colonies hydrolyzing AZCL and displaying the typical morphology of FZB42 (rough, flat, dendritic, translucent, white) were analyzed after 3 days for presence of an unique 785-bp DNA fragment by PCR using primers PRBrm5215 5′…TGATGGAGTAAATAATAAGGCTGG and PRBrm6000 5′… AATACATCTAAAGTTGCATCCACC. Amplification with two other primer pairs (Table 3) indicating presence of the nrs and pzn gene clusters was also found useful for examining the obtained colonies by either colony PCR or using isolated chromosomal DNA as template. The isolated colonies were examined for their ability to colonize plant roots using microbial standard techniques [7], and the genomes of the selected clones were sequenced to detect mutations possibly responsible for their improved capability to colonize plant roots. We propagated the most promising clones to obtain samples used in greenhouse and field trials. By using that approach, it was possible to obtain isolates with improved ability to colonize plant roots without engineering their genomes. Field trials to demonstrate enhanced positive response by the plant are underway.
Table 3

Characterization of isolates from soil samples obtained 5 months after application of FZB42 to Antirrhinum majus cultures in October 2009, Chengong County, Kunming

Strain

Lactose MM

Cellulose

RM (785 bp)

Nrs (839 bp)

Pzn (821 bp)

Morphology (nutrient agar)

FZB42

+

+

+

+

+

Rough, flat, dendritic, translucent, white

KM 1-1

+

+

+

+

+

As FZB42

KM 1-2

+

+

+

+

+

As FZB42

KM 1-3

+

+

+

+

+

As FZB42

KM 2A

+

+

+

+

+

As FZB42

KM 2B

+

+

+

+

+

As FZB42

KM3

+

+

+

+

+

As FZB42

KM 4-1

+

+

+

+

+

As FZB42

KM 4-2

+

+

+

+

+

As FZB42

KM 5-1

+

+

+

+

+

As FZB42

KM 5-2

+

+

+

+

+

As FZB42

KM 6-1

+

+

+

+

+

As FZB42

KM 6-2

+

+

+

+

+

As FZB42

DSM7T

+

Rough, white

B. subtilis DSM10T

+

Soft, cream

The colonies were analyzed after 3 days for presence of a unique 785-bp DNA fragment by PCR using primers PRBrm5215 and PRBrm6000 (see text). In addition, two other primer pairs PRBnrs3104 5′…tggagaaatatcactgaacaatgc and PRBnrs3943 5′…acgtttagtttcagttctttcacc for detection of the nrs gene cluster and PRBptn6179 5′gatagaagtattagcctggaagca and PRBptn7000 5′…tggaggaggtaacaattatgactc for detection of the pzn (plantazolicin) gene cluster were used. Annealing temperature of 55°C was generally used in PCR.

In the following, we describe in more detail, a possibility to obtain more efficient strains by applying genetic engineering techniques in the plant growth-promoting strain FZB42. This work has been performed in the laboratory of Xuewen Gao, Nanjing Agriculture University, China. We have to acknowledge that at present, use of such engineered PGPR strains under field conditions is refused by the public, at least in Europe. However, in light of a steadily increasing world's population growing from 7 billion now to 8.3 billion in 2025 [29], innovative approaches for getting higher harvest yields without using increasing amounts of agrochemicals should not longer be excluded, given that their use is safe and without harmful consequences for human beings and nature. Careful environmental studies are a precondition before releasing genetic engineered bacteria into the environment.

Case study: expression of the Harpin gene enhances biocontrol activity of FZB42

The plant immune system has gained recognition as a major factor in the growth and development of plants and the resistance to disease, predation, and environmental stress. The hrp (‘harp’) genes encode type III secretory proteins enabling many phytopathogenic bacteria to elicit a hypersensitive response (HR) on non-host or resistant host plants and induce pathogenesis on susceptible hosts. The HR is a rapid localized death of the host cells that occurs upon pathogen infection and, together with the expression of a complex array of defense-related genes, is a component of plant resistance. The plant genes create a cascade of effects which promote a systemic acquired resistance (SAR) throughout the plant. Beneficial effects on plant growth and health have been reported [30].

The hrp genes were first identified in Pseudomonas syringae pv. phaseolicola, a bean pathogen [31], and then in the plant pathogen Erwinia amylovora by the group of Steven Beer at Cornell University [32]. An optimized technology for producing the E. amylovora Harpin in a recombinant Escherichia coli strain was subsequently developed [33]. Today, Plant Health Care (PHC) promotes Harpin as foliar applicant and seed treatment on the global crop market.

Xanthomonas oryzae pv. oryzicola, the cause of bacterial leaf streak in rice, possesses clusters of hrp genes that determine its ability to elicit a HR in non-host tobacco and pathogenicity in host rice [34],[35]. The hpa1 gene of Xanthomonas oryzae pv. oryzae encodes a 13-kDa glycine-rich protein with a composition similar to those of the harpins in Xanthomonas spp. and PopA in Rhizoctonia solanaceum[36]. The hpa1 XooC gene was cloned and expressed in E. coli BL21 [37]. It is a member of the Harpin group of proteins, eliciting hypersensitive cell death in non-host plants, inducing disease and insect resistance in plants, and enhancing plant growth. Despite completely different sequence, its function was found very similar to that of the E. amylovora Harpin protein [38]. Transgenic tobacco plants expressing the hpa1 XooC gene were constructed but were found unable to induce hypersensitive cell death (HCD) [39].

The hpaG XooC gene had been cloned on an expression plasmid in B. subtilis OKB105, a derivative of B. subtilis 168 which is able to produce surfactin [40] and to colonize plant roots. Application experiments in tomato plants demonstrated that OKB105 expressing HpaGXooC was improved in its biocontrol activity [41]. However, after 100 generations, the HpaGXooC expression plasmid pM43HF is unstable in B. subtilis, which does not allow the use of this system under large-scale conditions in practice [42]. In order to overcome this difficulty, the groups from Nanjing Agricultural University and Humboldt University decided to use the plant growth-promoting model strain FZB42 as a host for establishing a durable and efficient HpaGXooC expression system [43]. In order to avoid proteolytic destruction of the recombinant harpin gene product, we removed the two main extracellular proteases Apr and Npr from FZB42. Chromosomal integration of two hpa1 genes cloned from X. oryzae under the control of the strong P43 promoter allowed stability and constitutive expression of the hpa1 gene product in FZB42. The experiment was described extensively in [43], but unfortunately in Chinese. Here, we present a short outline.

Briefly, two recombinant Harpin protein integration vectors, pGAprEHS (Figure 1) and pUNprEKHS (Figure 2), were constructed. The two vectors contained the powerful P43 promoter and the nprB signal peptide, which were fused with the gene encoding HpaGXooC. In addition, the vectors, which were unable to replicate freely in Bacillus cells, contained parts of the aprE and nprE sequences of FZB42, allowing their target-specific integration into the FZB42 chromosome. Transformation of pGAprEHS into competent cells of FZB42 resulted in the removal of the two main proteases, AprE and NprE, and yielding FZB42AN (Figure 3A). Subsequently, two copies of the hpa1 gene were inserted into the former protease gene sites in FZB42AN using plasmid pUNprEKHS. The resulting engineered strain FZBHarpin (Table 4) contained two copies of the hpa1 gene and the antibiotic marker fragments (lox-Km, lox-Spec, Cre-lox).
Figure 1

Construction of the Harpin expression vector pGAprEHS. The amplified partial FZB42 aprE gene sequence was cloned into pGEMT T/A vector resulting in pGEMT-aprE. Then, the gene encoding HpaGXooC was inserted into the double-digested (HpaI and ClaI) plasmid pGEMT-aprE resulting in pGAprEH. Finally, the antibiotic-resistance marker Spec was amplified from plasmid pIC333 and inserted into vector pGAprEH, yielding integration vector pGAprEHS. In addition, the aprE knockout vector pGAprES was obtained when the antibiotic cassette was inserted into plasmid pGEMT-aprE.

Figure 2

Construction of the Harpin expression vector pUNprEKHS. The resistance marker lox-Km was obtained from plasmid pBT2-arcA (Leibig et al. [45]) after PstI digestion and subsequent cloning into pUC18. The resulting plasmid was named pUK. The upstream and downstream sequences of the nprE gene were inserted into plasmid pUK, yielding nprE knockout vector pUNprEK. The Harpin gene fused with the P43 promoter and the nprE signal peptide was inserted into the Hinc II site of pUNprEK, yielding pUNprEKHS.

Figure 3

PCR analysis of FZBAN and FZBHarpin. (A) Validation of FZB42AN (FAN, DnprE DnprA, deficient in neutral and alkaline protease). Left: N, negative control (double distilled water); P, 844-bp fragment from the Km-containing plasmid; FAN 2 and FAN5, presence of the Km resistance cassette in two FZB42AN isolates. Right: N, negative control (double distilled water); P, 1,438-bp fragment from the Spec-containing plasmids; FAN 2 and FAN5, respectively, presence of the Spec resistance cassette in the two FZB42AN isolates. (B) Validation of FZBHarpin (FZBH, nprE::hpa1 nprA::hpa1). Lanes from left to right: presence of the spec resistance gene (1,438 bp) in FZB42Harpin, presence of the hpa1 gene (813 bp) in FZB42Harpin, presence of the his-tagged hpa1 gene (844 bp) in FZB42Harpin, and presence of the km resistance gene (880 bp) in FZB42Harpin.

Table 4

Strains and plasmids used for constructing FZB42Harpin

Strains/plasmids

Description

Reference or source

Plasmids

 pUC18

Cloning vector; lacZ Ap r

Lab collection

 pGEMT-easy

T/A-clone site vector; lacZ; Ap r

Promega Corp. Fitchburg, Wisconsin

 pBT2-arcA

Allelic replacement vector for Staphylococcus aureus containing a Km resistance cassette

Leibig et al. [45]

 pIC333

A vector carrying mini-Tn10 transposase gene for Bacillus subtilis, offer of Spec cassette

Laboratory stock

 pM43HF

Expression vector carrying hpa1 gene under the control of promoter p43 and the nprB signal peptide

Wu et al. [42]

 pGAprEHS

pGEM-T carrying a 2.8-kb fragment containing aprE, a 1.4-kb fragment lox-Spec and a 0.8-kb fragment hpa1; Apr, Specr

This study

 pGAprES

pGEM-T carrying a 2.8-kb fragment containing aprE, a 1.4-kb fragment lox-Spec; Apr, Specr

This study

 pUNprEKHS

pUC18 plasmid carrying a lox-Km cassette, nprE-L, nprE-R fragment, hpa1-his fragment; ApR, KmR

This study

 pUNprEK

pUC18 plasmid carrying a lox-Km cassette, nprE-L fragment and nprE-R fragment; ApR, KmR

This study

Strains

E. coli

  Topo10

F-mcrA Δ (mrr-hsdRMS-mcrBC φ 80lacZ Δ M15 Δ lacX74 nupG recA1 araD139 Δ (ara-leu)7697 galE15 galK16 rpsL(Str R ) endA1 λ

Invitrogen

Bacillus amyloliquefaciens

  FZB42

Type strain for Bacillus amyloliquefaciens subsp. plantarum

ABiTEP GmbH, Berlin, Germany

  FZB42/AHS

FZB42aprEnprE:: hpa1:: lox-Spec

This study

  FZBHarpin

FZB42aprEnprE:: hpa1:: hpa1his:: lox-Spec::lox-Km

This study

  FZBAN

FZB42aprEnprE:: lox-Spec::lox-Km

This study

Xanthomonas oryzae pv. oryzae POX99

This study

Experimental methods

The tobacco (Nicotiana tabacum cv. NC89) seeds were first soaked in FZB-derived strain suspensions with a final concentration of 1 × 108 CFU for 12 h and then disinfested in a 15% (w/v) solution of sodium hypochlorite for 15 min and washed three times with sterilized distilled water. These seeds were sown onto square Petri dishes (10 cm2) containing solidified Murashige medium. Each treatment included five plates with ten seeds each, and the experiment was replicated three times. The petri dishes were incubated in an illuminated incubator (200 μE m−2 s−1 at 25°C) with a 16-h day and 8-h night cycle. The root length was measured after 4 to 5 weeks.

FZB42, FZBAN, and FZBHarpin were cultivated in Landy medium at 30° and 200 rpm. Bacterial cultures were taken after 24, 48, and 72 h, respectively, and were infiltrated into the intercellular space of tobacco leaves (N. tabacum L. ‘xanthi’). The Landy medium and the Harpin protein purified from E. coli (50 ug · ml−1) served as the negative and positive controls, respectively. The development of the HR was registered after incubation for 24 to 36 h at room temperature.

The rice cultivar ‘Fengyou 22’ was used in this study. FZB-derived strains were shaken at 200 rpm at 30°C for 72 h. The culture was adjusted to about 1 × 108 CFU ml−1 with sterile distilled water for use. The rice seeds were surface-sterilized using sodium hypochlorite (15%, v/v) for 15 min, washed three times in sterile water, and allowed to germinate for 2 to 3 days at 25°C. Then, the seeds were soaked in the Bacillus spore suspension at 25°C for 2 h. The seeds were sown into sterile soil pots, containing a mixture of vermiculite and organic manure (1:1, w/w). Five plants are placed in each pot, and each treatment includes ten pots. These pots were cultivated in a greenhouse at 18°C to 30°C. After 45 days, the FZB suspension was diluted to 108 CFU ml−1 and used for spray treatment. After 1 day, the treated pots were inoculated with the bacterial leaf blight pathogen X. oryzae pv. oryzae POX99 (ca. 109 CFU ml−1). Bacterial leaf blight symptoms were assessed 21 days after inoculation. The height of the plants was measured.

Results and discussion

Quantitative real time PCR (qPCR) revealed constitutive expression of the two Harpin genes in the transgenic FZBHarpin strain (Figure 4). Although the harpin gene products were not detected in the supernatant of FZBHarpin by SDS-PA gel electrophoresis, their effect on tobacco plants were clearly visible: HR on tobacco was induced by supernatants taken from FZBHarpin cultures, demonstrating that biological active Harpin protein was secreted into the medium (Figure 5). Moreover, the plant growth-promoting effect of FZB42 was found to be increased in the FZB42Harpin derivative, as demonstrated by enhanced root growth. The average root length in FZB42Harpin was increased by 30% compared to the untreated control (Figure 6).
Figure 4

qPCR analysis of Harpin gene expression in strain FZBHarpin. Transcription of the HpaGXooC encoding gene in FZBHarpin was demonstrated by qPCR. Lanes: N, negative control (double distilled water); M, molecular marker DI2000; P, positive control (pM43HF); FZBHC, cDNA from FZBHarpin; FZBHR, RNA from FZBHarpin.

Figure 5

Hypersensitive response in tobacco elicited by FZBHarpin. The strains were cultivated in Landy medium, and the samples were taken after 72 h. One hundred microliters of the supernatant and of recombinant HrpXooC (15 μg · ml−1) were applied onto tobacco leaf surfaces, and the hypersensitive response was checked after 24 h.

Figure 6

Promotion of root growth of tobacco plants grown in MS medium by FZB42Harpin. The lengths of the roots were determined as follows: control (water) 49.25 mm (±3.25), control (Landy medium) 48.95 mm (±1.92), FZB42 55.17 mm (±1.12), FZBAN (Δapr, Δnpr) 61.79 mm (±1.23), and FZBHarpin (Δapr, Δnpr, 2x hrp XooC ) 64.05 mm (±1.81).

Greenhouse experiments demonstrated efficacy of FZBHarpin in biocontrolling rice bacterial blight. The control efficacy of FZB42Harpin was 51.9%. In addition, a plant growth-promoting effect by FZB42Harpin exceeding that of FZB42 was also detected (Table 5). Before applying the recombinant FZB42Harpin strain in field trials, removal of the two resistance markers flanked by the Cre-lox recombinase recognition sites via site-directed recombination has to be performed.
Table 5

The biocontrol efficacy (rice bacterial blight) and plant growth promotion by FZB42, FZB42AN, and FZB42Harpin

Strain

Disease index (%)

Control efficacy (%)

Plant height (cm)

-

44.25 ± 2.82 a

-

71.75 ± 3.54 c

FZB42

36.57 ± 1.73 b

17.4

75.92 ± 1.88 b

FZBAN

28.97 ± 2.01 c

34.5

80.33 ± 1.53 a

FZBHarpin

21.26 ± 2.73 d

51.9

82.58 ± 0.80 a

Test was performed with tobacco plants. Groups designated as a, b, c are significantly different.

Outlook: how to improve acceptance for use of genetic engineered bacteria for enhancing crop yield?

Today, application and release of genetic engineered bacteria directly in the environment is not accepted by the public, and governmental regulations are contradictory for use of such microorganisms in enhancing crop yield. One reason is the presence of resistance genes in transgenic strains, which have been introduced in the bacteria during the allelic replacement process, and methods avoiding use of such marker genes are therefore highly desirable.

Today there are several methods for marker removal available. Wang et al. [44] developed a simple and efficient B. subtilis genome editing method in which targeted gene(s) could be inactivated by single-stranded PCR product(s) flanked by short homology regions, and in-frame deletion could be achieved by incubating the transformants at 42°C. In this process, homologous recombination was promoted by the lambda beta protein synthesized under the control of promoter PRM in the lambda cI857 PRM-PR promoter system on a temperature-sensitive plasmid pWY121.

Alternatively, site-specific recombination systems are capable of eliminating antibiotic resistance markers, if they are flanked by recombinase recognition sites as it is the case in FZB42Harpin. In a previous study [45], a Cre-lox setting was established that allowed the efficient removal of resistance genes from the genomes of Staphylococcus carnosus and Staphylococcus aureus. Two cassettes conferring resistance to erythromycin or kanamycin were flanked with wild-type or mutant lox sites, respectively, and used to delete single genes and an entire operon. After transformation of the cells with a newly constructed cre expression plasmid, genomic eviction of the resistance genes was observed in approximately one out of ten candidates analyzed and subsequently verified by PCR. Due to its thermo-sensitive origin of replication, the plasmid can be eliminated at non-permissive temperatures, and markerless deletion mutants can be obtained. Before applying the engineered FZB42Harpin under non-containment conditions, we have to perform marker removal by one of the methods described above.

Of course, marker removal is not the only precondition for improved acceptance of genetically engineered strains when released into the environment. As stated above, careful case studies demonstrating that no harmful effects caused by genetic engineered strains are urgently needed. In applying genetic engineered plant growth-promoting bacteria, we have to distinguish two different levels:
  1. (1)

    Engineered strains without foreign genes but containing useful mutations in genes affecting the beneficial effect of the bacterium in terms of plant growth promotion and biocontrol of pathogens. Given that no resistance marker has been introduced, it might be unimportant whether the useful mutation has been introduced by a targeted allele exchange or has been evolved after applying a natural selection procedure. We believe that such strains will be accepted in the future when their improved action has been convincingly demonstrated.

     
  2. (2)

    Engineered strains containing genes from bacteria. Such bacteria will be considered as ‘recombinant’ , also when the donor bacteria occur in the same natural environment. This was the case in the example described here. Ironically, the harpin gene isolated from a pathogen bacterium was shown to act beneficial when cloned and expressed in FZB42. However, long-term environmental studies are necessary to demonstrate that such recombinant bacteria do not harm the environment by novel recombination events with other microorganisms occurring in the same environment.

     

Conclusions

Biologicals prepared from beneficial microbes are useful and environmental-friendly tools for developing a sustainable and efficient agriculture. In this context, genomic analysis and genetic engineering of promising beneficial microbes are helpful for obtaining improved bioformulations. This strategy should enable us to save considerable amounts of agrochemicals, especially chemical fertilizers, and chemical pesticides.

Authors’ information

JQQ is scientific coworker of Jiangsu Academy of Agricultural Sciences, Nanjing. HJW and RH are graduate students in the laboratory of XWG, Nanjing Agriculture University, Nanjing. RB is Prof. em. of Humboldt University Berlin and Director of Research at ABiTEP GmbH Berlin.

Declarations

Acknowledgements

The work of X. Gao was supported by grants from the National High-Tech R&D Program of China (2012AA101504), the Special Fund for Agro-Scientific Research in the Public Interest (20130315), the National Natural Science Foundation of China (31471811), and the Doctoral Fund of Ministry of Education of China (20100097120011). R.B. wishes to thank for the support given by the European's Seventh Framework Programme (FP/2007-2013) under Grant Agreement no. 312117.

Authors’ Affiliations

(1)
College of Plant Protection, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Crop Disease and Pest Insects, Ministry of Agriculture
(2)
Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences
(3)
Institute of Biology/Bacterial Genetics, Humboldt University
(4)
ABiTEP GmbH

References

  1. Borriss R (2011) Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents. In: Maheshwari DK (ed) Bacteria in agrobiology: plant growth responses. Springer Heidelberg, Dordrecht, London, New York, pp 41–76Google Scholar
  2. Borriss R, Chen XH, Rueckert C, Blom J, Becker A, Baumgarth B, Fan B, Pukall R, Schumann P, Sproer C, Junge H, Vater J, Pühler A, Klenk HP (2011) Relationship of Bacillus amyloliquefaciens clades associated with strains DSM 7T and Bacillus amyloliquefaciens subsp. plantarum subsp. nov. based on their discriminating complete genome sequences. Int J Syst Evol Microbiol 61:1786–1801Google Scholar
  3. Krebs B, Hoding B, Kubart S, Workie MA, Junge H, Schmiedeknecht G, Grosch R, Bochow H, Hevesi M: Use of Bacillus subtilis as biocontrol agent I. Activities and characterization of Bacillus subtilis strains. Z Pflanzenk Pflanzen. 1998, 105: 181-197.Google Scholar
  4. Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O, Junge H, Voigt B, Jungblut PR, Vater J, Süssmuth R, Liesegang H, Strittmatter A, Gottschalk G, Borriss R: Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol. 2007, 25: 1007-1014. 10.1038/nbt1325.View ArticlePubMedGoogle Scholar
  5. Kenrick P, Crane PR: The origin and early evolution of plants on land. Nature. 1997, 389: 33-39. 10.1038/37918.View ArticleGoogle Scholar
  6. Hirsch PR, Miller AJ, Dennis PG: Do root exudates exert more influence on rhizosphere bacterial community structure than other rhizodeposits?. Molecular microbial ecology of the rhizosphere. Edited by: Bruyn FJ. 2013, Wiley, Hoboken, vol. 1 pp 229–242Google Scholar
  7. Chowdhury SP, Dietel K, Rändler M, Schmid M, Junge H, Borriss R, Hartmann A, Grosch R: Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere community. PLoS One. 2013, 8 (7): e68818-10.1371/journal.pone.0068818.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Fan B, Chen XH, Budiharjo A, Bleiss W, Vater J, Borriss R: Efficient colonization of plant roots by the plant growth promoting bacterium Bacillus amyloliquefaciens FZB42, engineered to express green fluorescent protein. J Biotechnol. 2011, 151: 303-311. 10.1016/j.jbiotec.2010.12.022.View ArticlePubMedGoogle Scholar
  9. Dietel K, Beator B, Budiharjo A, Fan B, Borriss R: Bacterial traits involved in colonization of Arabidopsis thaliana roots by Bacillus amyloliquefaciens FZB42. Plant Pathol J. 2013, 29: 59-66. 10.5423/PPJ.OA.10.2012.0155.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Fan B, Borriss R, Bleiss W, Wu XQ: Gram-positive rhizobacterium Bacillus amyloliquefaciens FZB42 colonizes three types of plants in different patterns. J Microbiol. 2012, 50: 38-44. 10.1007/s12275-012-1439-4.View ArticlePubMedGoogle Scholar
  11. Budiharjo A, Chowdhury SP, Dietel K, Beator B, Dolgova O, Fan B, Bleiss W, Ziegler J, Schmid M, Hartmann A, Borriss R: Transposon mutagenesis of the plant-associated Bacillus amyloliquefaciens ssp. plantarum FZB42 revealed that the nfrA and RBAM17410 genes are involved in plant-microbe interactions. PLoS One. 2014, 9 (5): e98267-10.1371/journal.pone.0098267.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Chen XH, Koumoutsi A, Scholz R, Borriss R: More than anticipated - production of antibiotics and other secondary metabolites by FZB42. J Mol Microbiol Biotechnol. 2009, 16: 14-24. 10.1159/000142891.View ArticlePubMedGoogle Scholar
  13. Rueckert C, Blom J, Chen XH, Reva O, Borriss R (2011) Genome sequence of Bacillus amyloliquefaciens type strain DSM7T reveals differences to plant-associated Bacillus amyloliquefaciens FZB42. J Biotechnol 155:78–85Google Scholar
  14. Chen XH, Vater J, Piel J, Franke P, Scholz R, Schneider K, Koumoutsi A, Hitzeroth G, Grammel N, Strittmatter AW, Gottschalk G, Sussmuth RD, Borriss R: Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42. J Bacteriol. 2006, 188: 4024-4036. 10.1128/JB.00052-06.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Schneider K, Chen XH, Vater J, Franke P, Nicholson G, Borriss R, Süssmuth RD: Macrolactin is the polyketide biosynthesis product of the pks2 cluster of Bacillus amyloliquefaciens FZB42. J Nat Prod. 2007, 70: 1417-1423. 10.1021/np070070k.View ArticlePubMedGoogle Scholar
  16. Borriss R (2013) Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. In: de Brujn FJ (ed) Molecular microbial ecology of the rhizosphere. Wiley, Hoboken. vol. 2, pp. 883–898Google Scholar
  17. He P, Hao K, Blom J, Rueckert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y, Borriss R: Genome sequence of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and expression of mersacidin and other secondary metabolites. J Biotechnol. 2012, 164: 281-291. 10.1016/j.jbiotec.2012.12.014.View ArticlePubMedGoogle Scholar
  18. Scholz R, Molohon KJ, Nachtigall J, Vater J, Markley AL, Süssmuth RD, Mitchell DA, Borriss R: Plantazolicin, a novel microcin B17/streptolysin S-like natural product from Bacillus amyloliquefaciens FZB42. J Bacteriol. 2010, 193: 215-224. 10.1128/JB.00784-10.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Scholz R, Vater J, Budiharjo A, Wang Z, He Y, Dietel K, Schwecke T, Herfort S, Lasch P, Borriss R: Amylocyclicin, a novel circular bacteriocin produced by Bacillus amyloliquefaciens FZB42. J Bacteriol. 2014, 196: 1842-52. 10.1128/JB.01474-14.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Fan B, Carvalhais LC, Fedoseyenko D, von Wiren N, Borriss R: Transcriptomic profiling of Bacillus amyloliquefaciens FZB42 in response to maize root exudates. BMC Microbiol. 2012, 12: 116-10.1186/1471-2180-12-116.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Carvalhais LC, Dennis PG, Fan B, Fedoseyenko D, Kierul K, Becker A, von Wiren N, Borriss R: Linking plant nutritional status to plant-microbe interactions. PLoS One. 2013, 8 (7): e68555-10.1371/journal.pone.0068555. doi:10.1371/journal.pone.0068555PubMed CentralView ArticlePubMedGoogle Scholar
  22. Lugtenberg BJJ, Dekkers L, Bloemberg GV: Molecular determinants of rhizosphere colonization by Pseudomonas. Annu Rev Phytopathol. 2001, 39: 461-490. 10.1146/annurev.phyto.39.1.461.View ArticlePubMedGoogle Scholar
  23. Weng J, Wang Y, Li J, Shen Q, Zhang R: Enhanced root colonization and biocontrol activity of Bacillus amyloliquefaciens SQR9 by abrB gene disruption. Appl Microbiol Biotechnol. 2013, 97: 8823-8830. 10.1007/s00253-012-4572-4.View ArticlePubMedGoogle Scholar
  24. Idris ES, Iglesias DJ, Talon M, Borriss R: Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol Plant-Microbe Interact. 2007, 20: 619-626. 10.1094/MPMI-20-6-0619.View ArticlePubMedGoogle Scholar
  25. Koumoutsi A, Chen XH, Vater J, Borriss R: DegU and YczE positively regulate the synthesis of bacillomycin D by Bacillus amyloliquefaciens strain FZB42. Appl Environ Microbiol. 2007, 73: 6953-6964. 10.1128/AEM.00565-07.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Mariappan A, Makarewicz O, Chen XH, Borriss R: Two-component response regulator DegU controls the expression of bacilysin in plant-growth-promoting bacterium Bacillus amyloliquefaciens FZB42. J Mol Microbiol Biotechnol. 2012, 22: 114-125. 10.1159/000338804.View ArticlePubMedGoogle Scholar
  27. Borriss R, Junge H, Gao XW, Wang Q, He Y (2010) Experiences in applying Bacillus-based biocontrol agents in Chinese agriculture. In: Conference Proceedings of the IOBC/WPRS Working Group “Biological control of fungal and bacterial plant pathogens”; Graz, Austria 06/2010.Google Scholar
  28. Bais HP, Fall R, Vivanco JM: Biocontrol of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol. 2004, 134: 307-319. 10.1104/pp.103.028712.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Lugtenberg BJJ, Malfanova N, Kamilova F, Berg G: Plant growth promotion by microbes. Molecular microbial ecology of the rhizosphere. Edited by: Brujn FJ. 2013, Wiley, Hoboken, vol. 2, pp. 561–573Google Scholar
  30. Alfano JR, Collmer A: Type 3 secretion system effector proteins: double agents in bacterial disease and plant defense. Annu Rev Phytopathol. 2004, 42: 385-414. 10.1146/annurev.phyto.42.040103.110731.View ArticlePubMedGoogle Scholar
  31. Lindgren PB, Peet RC, Panopoulos NJ: Gene cluster of Pseudomonas syringae pv phaseolicola controls pathogenicity on bean plants and hypersensitivity on nonhost plants. J Bacteriol. 1986, 168: 512-522.PubMed CentralPubMedGoogle Scholar
  32. Wei ZM, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A, Beer SV: Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science. 1992, 257: 85-88. 10.1126/science.1621099.View ArticlePubMedGoogle Scholar
  33. Baker CJ, Orlandi EW, Mock NM: Harpin an elicitor of the hypersensitive response in tobacco caused by Erwinia amylovora elicits active oxygen production in suspension cells. Plant Physiol. 1993, 102: 1341-1344.PubMed CentralPubMedGoogle Scholar
  34. Zhu WG, Magbanua MM, White FF: Identification of two novel hrp-associated genes in the hrp gene cluster of Xanthomonas oryzae pv. oryzae. J Bacteriol. 2000, 182: 1844-1853. 10.1128/JB.182.7.1844-1853.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Zou LF, Wang XP, Xiang Y, Zhang B, Li YR, Xiao YL, Wang JS, Walmsley AR, Chen GY: Elucidation of the hrp clusters of Xanthomonas oryzae pv. oryzicola that control the hypersensitive response in nonhost tobacco and pathogenicity in susceptible host rice. Appl Environ Microbiol. 2006, 72: 6212-6224. 10.1128/AEM.00511-06.PubMed CentralView ArticlePubMedGoogle Scholar
  36. Zhou L, Chen G, Wu X, Wang J: Cloning and sequence analysis of diverse members of avrBs3/PthA family of Xanthomonas oryzae pv. oryzicola. Sci Agric Sin. 2005, 38: 929-935.Google Scholar
  37. Li P, Lu XZ, Shao M, Long JY, Wang JS: Genetic diversity of harpins from Xanthomonas oryzae and their activity to induce hypersensitive response and disease resistance in tobacco. Sci China C Life Sci. 2004, 47: 461-469. 10.1360/03yc0152.View ArticlePubMedGoogle Scholar
  38. Liu FQ, Liu HX, Jia Q, Wu XJ, Guo S, Zhang J, Song F, Dong HS: The internal glycine-rich motif and cysteine suppress several effects of the HpaG(XooC) protein in plants. Phytopathology. 2006, 96: 1052-1059. 10.1094/PHYTO-96-1052.View ArticlePubMedGoogle Scholar
  39. Peng JL, Bao ZL, Ren HY, Wang JS, Dong HS: Expression of harpinXoo in transgenic tobacco induces pathogen defense in the absence of hypersensitive cell death. Phytopathology. 2004, 94: 1048-1055. 10.1094/PHYTO.2004.94.10.1048.View ArticlePubMedGoogle Scholar
  40. Nakano MM, Marahiel MA, Zuber P: Identification of a genetic locus required for biosynthesis of the lipopeptide antibiotic surfactin in Bacillus subtilis. J Bacteriol. 1988, 170: 5662-5668.PubMed CentralPubMedGoogle Scholar
  41. Gao S, Wu H, Wang W, Yang Y, Xie S, Xie Y, Gao X: Efficient colonization and harpins mediated enhancement in growth and biocontrol of wilt disease in tomato by Bacillus subtilis. Lett Appl Microbiol. 2013, 57: 526-533. 10.1111/lam.12144.View ArticlePubMedGoogle Scholar
  42. Wu HJ, Wang S, Qiao JQ, Liu J, Zhan J, Gao XW (2008) Expression of HpaGXooC protein in Bacillus subtilis and its biological functions. J Microbiol Biotechnol 19:194-203Google Scholar
  43. Qiao J, Wu HJ, Huo R, Borriss R, Gao XW: Construction of Harpin expression engineering strain FZBHarpin and evaluation of its biocontrol activity. J Nanjing Agric Univ. 2013, 36: 37-44.Google Scholar
  44. Wang Y, Weng J, Waseem R, Yin X, Zhang R, Shen Q: Bacillus subtilis genome editing using ssDNA with short homology regions. Nucleic Acids Res. 2012, 40: 12e91-Google Scholar
  45. Leibig M, Krismer B, Kolb M, Friede A, Götz F, Bertram R: Marker removal in Staphylococci via Cre recombinase and different lox sites. Appl Environ Microbiol. 2008, 2008 (74): 1316-1323. 10.1128/AEM.02424-07.View ArticleGoogle Scholar

Copyright

© Qiao et al.; licensee Springer. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.

Advertisement