Skip to main content

Table 3 Characterization of isolates from soil samples obtained 5 months after application of FZB42 to Antirrhinum majus cultures in October 2009, Chengong County, Kunming

From: Stimulation of plant growth and biocontrol by Bacillus amyloliquefaciens subsp. plantarum FZB42 engineered for improved action

Strain

Lactose MM

Cellulose

RM (785 bp)

Nrs (839 bp)

Pzn (821 bp)

Morphology (nutrient agar)

FZB42

+

+

+

+

+

Rough, flat, dendritic, translucent, white

KM 1-1

+

+

+

+

+

As FZB42

KM 1-2

+

+

+

+

+

As FZB42

KM 1-3

+

+

+

+

+

As FZB42

KM 2A

+

+

+

+

+

As FZB42

KM 2B

+

+

+

+

+

As FZB42

KM3

+

+

+

+

+

As FZB42

KM 4-1

+

+

+

+

+

As FZB42

KM 4-2

+

+

+

+

+

As FZB42

KM 5-1

+

+

+

+

+

As FZB42

KM 5-2

+

+

+

+

+

As FZB42

KM 6-1

+

+

+

+

+

As FZB42

KM 6-2

+

+

+

+

+

As FZB42

DSM7T

+

−

−

−

−

Rough, white

B. subtilis DSM10T

−

+

−

−

−

Soft, cream

  1. The colonies were analyzed after 3 days for presence of a unique 785-bp DNA fragment by PCR using primers PRBrm5215 and PRBrm6000 (see text). In addition, two other primer pairs PRBnrs3104 5′…tggagaaatatcactgaacaatgc and PRBnrs3943 5′…acgtttagtttcagttctttcacc for detection of the nrs gene cluster and PRBptn6179 5′gatagaagtattagcctggaagca and PRBptn7000 5′…tggaggaggtaacaattatgactc for detection of the pzn (plantazolicin) gene cluster were used. Annealing temperature of 55°C was generally used in PCR.