Skip to main content
Chemical and Biological Technologies in Agriculture
Download PDF
Download ePub

Establishment of transient and stable gene transformation systems in medicinal woody plant Acanthopanax senticosus

Chemical and Biological Technologies in Agriculture volume 11, Article number: 142 (2024) Cite this article

Abstract

Background

Transient and stable gene transformation systems play a crucial role in elucidating gene functions and driving genetic improvement in plants. However, their application in medicinal woody plants has been hampered by inefficient procedures for isolating protoplasts and regenerating plants in vitro.

Results

Embryogenic callus protoplast isolation and transient transformation system were successfully established. The highest yield of protoplasts was approximately 1.88 × 106 cells per gram with a viability of 90% under the combination of 1.5% cellulase and 0.2% macerozyme, with enzymatic digestion for 6 h in darkness followed by centrifugation at 400×g for 5 min. The transient transfection rate of protoplast reached 45.56% at a PEG 4000 concentration of 40%, a transfection time of 40 min, 16 h of dark incubation, a plasmid concentration of 1.5 ng μL−1, and 25 min heat shock at 45 °C. In addition, 15 Agrobacterium tumefaciens-mediated GUS-positive seedlings were obtained through the somatic embryogenetic pathway under the optimized conditions.

Conclusion

This study successfully established both transient and stable genetic transformation systems, paving the way for future molecular biology research on A. senticosus.

Graphical Abstract

Introduction

Acanthopanax senticosus (Rupr. & Maxim.) Harms is a medicinal and edible plant belonging to the Acanthopanax genus in the Araliaceae family [1]. It is called “ciwujia” in Chinese due to its densely covered prickles and the unique arrangement of its leaves in groups of five. As documented in “Shen Nong’s Herbal Classic,” A. senticosus holds a distinguished status among top-quality Chinese medicinal herbs. Its roots, rhizomes, and stems are prized components in traditional medicine and are recognized for their ability to tonify the kidney and spleen, dispel wind dampness, calm Qi, and fortify muscles and bones [1, 2]. Modern pharmacological research has revealed the presence of key active substances in A. senticosus, including glycosides (such as syringin, acanthopanax E, and triterpenoid saponins), flavonoids (such as hypericin and quercetin), polysaccharides, and coumarins [3, 4]. These compounds confer various health benefits, such as neuroprotection, anti-tumor effects, antioxidation, anti-aging properties, blood sugar regulation, and immune system modulation [2]. Currently, leveraging traditional products such as A. senticosus injection and extract has produced a diverse array of health products, including A. senticosus original pulp, beverages, and teas [5, 6]. However, recent years have seen a shortage of A. senticosus raw materials due to the expanding market demand.

With the continuous development of molecular biology and biochemical technology, the biosynthetic pathways of active compounds in medicinal plants are gradually being identified [3, 7, 8]. Exploring the components involved in the biosynthesis of active ingredients ensures that genetic engineering and synthetic biology methods can be used to redesign existing natural biological systems in plants or yeast [9, 10]. Such advancements not only streamline the production process of traditional Chinese medicine formulations but also alleviate pressure on medicinal plant resources by reducing extraction costs. For example, researchers have successfully synthesized various natural bioactive substances such as tropane alkaloids, ginsenoside Rh2, artemisinin, taxol precursor, and vincristine by reconstructing pathways in tobacco or yeast [11,12,13,14,15]. However, research on A. senticosus is still at an early stage. Currently, only reports on its genome and tissue culture regeneration system are available.

Protoplasts play a pivotal role in biochemistry, physiology, genetics, and synthetic biology research, enabling studies ranging from somatic hybridization to CRISPR/Cas9 gene editing, gene transfer, and specialized metabolite synthesis [16]. The polyethylene glycol (PEG)-mediated transient transformation system for plant protoplasts is a fast, efficient, and straightforward method [17]. Meanwhile, Agrobacterium tumefaciens-mediated genetic transformation offers a stable approach with broad applicability, high conversion rates, predominantly single-copy integration, and stable expression, making it invaluable for plant gene function studies and the creation on new germplasms [18]. Despite their advantages, the conversion efficiency of these methods can be hindered by various factors, including recipient plants, genotypes, explants, vectors, bacterial strains, and medium composition. To address this issue, we optimized protocols for protoplast separation and genetic transformation, successfully establishing a PEG-mediated transient transformation system by using protoplasts from embryonic callus and a stable transformation system via the Agrobacterium tumefaciens-mediated somatic embryogenesis pathway. These advancements pave the way for analyzing the biosynthetic pathway of A. senticosus and unraveling its key synthetic gene network.

Materials and methods

Plant material

Acanthopanax senticosus seeds were washed thoroughly in running water for 2 h, and then they were sterilized in 75% ethanol for 90 s and immersed in 5% sodium hypochlorite for 10 min. Then, they were washed with sterilized distilled water three to five times. Zygotic embryos obtained from the sterilized seeds were placed on Murashige and Skoog (MS) medium supplemented with 30 g·L−1 sucrose. These cultures were then maintained under a photoperiod of 16 h of light and 8 h of darkness at approximately 25 ℃ until they developed into seedlings. The leaves of these seedlings were inoculated on MS + 0.5 mg L−1 2,4-D + 1.0 mg L−1 6-BA medium to induce callus formation, and then callus was subcultured onto MS medium containing 1.0 mg L−1 2,4-D for proliferation [19]. The proliferated callus tissue was further subcultured onto hormone-free MS medium to induce the formation of embryogenic callus. This cultivation phase was conducted under dark conditions.

Protoplast isolation and purification

The protoplast isolation process was carried out following previously established methods with certain modifications [17, 20]. One gram of embryogenic callus was placed in a 10-mL centrifuge tube filled with 10 mL of enzyme solution consisting of 0.5% to 2% cellulase, 0.2% to 1.5% macerozyme, 10 mmol L−1 CaCl2, 20 mmol L−1 MES, 0.1% (w/v) BSA, and 0.6 mol L−1 mannitol, adjusted to pH 5.7 (Table 1). The mixture underwent enzymatic digestion for 1–12 h at room temperature without light, with oscillation at a speed of 50 rpm. Subsequently, an equal volume of pre-cooled W5 solution (composed of 2 mmol L−1 MES, 154 mmol·L−1 NaCl, 125 mmol L−1 CaCl2, 5 mmol L−1 KCl, pH 5.7) was added to the protoplast–enzyme blend. The enzymatic solution was then filtered through a 325-mesh cell sieve pre-wetted with W5 solution. The filtrate was centrifuged at 4 °C, 200–1000×g for 5 min, and the supernatant was discarded. This washing process was repeated three times by rinsing with W5 solution followed by centrifugation. Finally, the resulting precipitate was suspended in W5 solution to yield purified protoplasts.

Table 1 Factors and levels of orthogonal tests for protoplast isolation
Full size table

Protoplast yield was quantified by pipetting 10 μL of suspended protoplast drops onto a 0.1 mm blood cell counting plate. Each sample was meticulously counted three times to ensure accuracy, and the average count was recorded. Protoplast yield (PCS g−1) was calculated by multiplying the number of protoplasts (PCS mL−1) by the volume of the purified suspension and then dividing by the mass of the enzymatically treated material.

The viability of the protoplasts was assessed by staining with fluorescein diacetate (FDA) and observing them under bright-field and fluorescence microscopy. Five fields were viewed for each biological replicate, and the average value was used to calculate protoplast viability. Protoplast activity was determined as the ratio of green fluorescent protoplasts in the visual field to the total number of protoplasts.

PEG-mediated protoplast transformation

The transfection protocol involved the addition of 20 μL pCAMBIA1301-35SN-GFP plasmid DNA into a 2-mL centrifuge tube containing 100 μL of protoplast suspension mixed with 110 μL of PEG 4000. After incubation for 15 min at room temperature in darkness, 440 μL of W5 solution was added to halt the transformation process. Subsequently, the mixture was centrifuged at 400g for 4 min, and the supernatant was removed. The protoplasts were then suspended in 1 mL of WI solution (comprising 0.5 mol L−1 mannitol, 4 mmol L−1 MES, and 20 mmol L−1 KCl) and transferred to 12-well cell culture plates for incubation in darkness at room temperature.

Several factors affecting transfection efficiency were investigated, including PEG 4000 concentration, transfection duration, culture period, plasmid concentration, and heat shock duration. PEG 4000 concentrations ranging from 20 to 50% were tested, along with transfection durations varying from 20 to 50 min. The culture period in darkness spanned from 14 to 20 h. Moreover, different plasmid concentrations of 0.5, 1, 1.5, and 2 ng μL−1 were examined, and heat shock treatments were administered for durations ranging from 15 to 30 min at 45 °C.

Fluorescence microscopy was employed to visualize GFP expression in the transfected protoplasts, utilizing 480 nm excitation light and 510 nm emission light. Transfection efficiency was determined by calculating the ratio of fluorescent protoplasts to the total number of protoplasts, multiplied by 100. Five microscopic fields were observed for each biological replicate to ensure accurate measurement, and the average was taken.

Agrobacterium tumefaciens-mediated GUS gene transformation

The plasmid containing pCAMBIA1301-35SN-GUS was introduced into A. senticosus plants via Agrobacterium-mediated transformation, following the method described by Fan et al. [21]. Transgenic A. senticosus plants were cultured on MS medium under the same conditions as the embryogenic callus. Various factors affecting transfection efficiency were explored, including infection time (15, 20, and 25 min), Agrobacterium concentration (OD values of 0.4, 0.6, and 0.8), ultrasound duration (15, 20, and 25 min), vacuum duration (15, 20, and 25 min), dithiothreitol (DTT) concentration (1, 2, and 3 mmol L−1), and 5-azactidine concentration (50, 100, and 150 μmol L−1). Transfection efficiency was assessed using 50 mg L−1 hygromycin-resistant callus.

The regenerated cotyledon embryos were authenticated using GUS histochemical assay, following the method outlined by Jefferson [22]. Subsequently, their total DNA was extracted by using a plant genomic DNA extraction kit (DP305, TianGen, Beijing, China), following the manufacturer’s guidelines. Polymerase chain reaction (PCR) analysis was conducted using the following primer sequences: forward (F): AACCACAAACCGTTCTACTTTACTG, reverse (R): CAGAACATTACATTGACGCAGGT. PCR amplification was performed under the standard cycling conditions, namely, initial denaturation at 94 °C for 4 min, followed by 35 cycles of denaturation at 98 °C for 8 s, annealing at 59 °C for 45 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min [21]. The resulting PCR products were visualized by electrophoresis on a 1.0% (w/v) agarose gel.

Results

Induction of embryogenic callus

The leaves of one-month-old sterile seedlings derived from zygotic embryos were inoculated onto MS medium supplemented with 0.5 mg L−1 2,4-D and 1.0 mg L−1 6-BA for dark culture. After approximately 15 days of leaf inoculation, callus tissue was observed at the edge of the explants, which was then subcultured onto MS medium containing 1.0 mg·L−1 2,4-D for proliferation. The proliferated callus tissue was further subcultured onto hormone-free MS medium to induce the formation of embryogenic callus. The embryogenic callus that was formed was then used for protoplast isolation (Fig. 1).

Fig. 1
figure 1

The process of embryogenic callus induction. Embryogenic callus developed from the leaves of A. senticosus seedlings was inoculated on MS + 0.5 mg L−1 2,4-D + 1.0 mg L−1 6-BA medium to induce callus formation, and then callus was further subcultured onto hormone-free MS medium to induce the formation of embryogenic callus. Embryogenic callus was used for the isolation of protoplasts. Bar = 1 mm. A Sterilized seed, B Sterile seedlings, C Sterile leaf, D and E callus, F Embryogenic callus

Full size image

Protoplast isolation from embryogenic callus

The yield and activity of protoplasts under the orthogonal design of cellulase concentration, macerozyme concentration, enzymolysis time, and centrifugal force are shown in Table 2. The highest yield of protoplasts was approximately 1.88 × 106 cells per gram with a viability of 90% under the combination of 1.5% cellulase and 0.2% macerozyme, with enzymatic digestion for 6 h in darkness followed by centrifugation at 400×g for 5 min. The range analysis results indicated that the effects of each factor on the separation yield of protoplasts were ranked as follows: cellulase concentration, enzymolysis time, macerozyme concentration, and centrifugal force. The protoplasts isolated by the above optimization conditions were intact and exhibited a full, rounded appearance. Upon FDA staining, the viable protoplasts emitted green fluorescence with about 80% frequency (Fig. 2).

Table 2 Optimization of protoplast separation conditions
Full size table
Fig. 2
figure 2

Protoplasts obtained under optimized conditions. Protoplast activity was assessed by staining with fluorescein diacetate (FDA) and observing them under bright-field and fluorescence microscopy. Five views were observed for each biological replicate, and the average value was used to calculate protoplast viability. Protoplast activity was determined as the ratio of green fluorescent protoplasts in the visual field to the total number of protoplasts A Protoplasts under bright field; B Protoplasts under fluorescence microscope

Full size image

PEG-mediated transient transfection of protoplasts

eGFP gene was used as reporter to evaluate the transformation efficiency. PEG 4000 concentration, transfection duration, incubation duration, plasmid concentration, and heat shock time were used to optimize the transient transformation system in the protoplast of A. senticosus (Fig. 3). The results revealed that within the range of 20% to 50% PEG 4000, the transformation efficiency peaked at 40% concentration, reaching a maximum of 21.71%. Under 40% PEG 4000, with transfection durations of 20, 30, 40, and 50 min, the maximum transfection efficiency of 30.34% was achieved at 40 min. At 40% PEG 4000 for 40 min, the transfection efficiency peaked at 35.21% after 16 h of dark culture within the range of 14–20 h. At 40% PEG 4000 for 40 min transfection after 16 h of culture, the maximum transfection efficiency reached 40.87% at 1.5 ng μL−1 plasmid concentration within the range of 0.5–2 ng μL−1. Finally, heat shock duration between 15 and 30 min at 45 °C resulted in a peak transfection efficiency of 45.56% at 25 min.

Fig. 3
figure 3

Graphical presentation of transfection efficiency in A. senticosus protoplasts under different factors such as PEG 4000 concentration, transfection duration, culture period, plasmid concentration, and heat shock duration. Fluorescence microscopy was employed to visualize GFP expression in the transfected protoplasts, utilizing 480 nm excitation light and 510 nm emission light. Transfection efficiency was determined by calculating the ratio of fluorescent protoplasts to the total number of protoplasts, multiplied by 100. Data presented are an average of observations of five fields of the biological replicate under the microscope. Different letters above bars represent a statistically significant difference at p < 0.05, according to Tukey’s test

Full size image

In summary, the best conditions for transient protoplast transfection were a PEG 4000 concentration of 40%, a transformation time of 40 min, 16 h of dark incubation, a plasmid concentration of 1.5 ng μL−1, and a 25 min heat shock at 45 °C. With these optimized parameters, eGFP was successfully introduced into protoplasts, resulting in vibrant green fluorescence and a transfection rate of 45.56% (Fig. 4).

Fig. 4
figure 4

PEG-mediated transient GFP gene expression in protoplast of A. senticosus. Fluorescence microscopy was employed to visualize GFP expression in the transfected protoplasts, utilizing 480 nm excitation light and 510 nm emission light

Full size image

Agrobacterium tumefaciens-mediated genetic transformation

Genetic transformation of A. senticosus stem and leaf explants was performed, revealing varying transformation efficiencies across different parameters (Fig. 5). Notably, an infection time of 20 min exhibited the highest efficiency of 26.80%; infection times of 25 and 15 min achieved efficiencies of 18.75% and 13.76%, respectively. Similarly, a bacterial solution OD600 value of 0.6 resulted in the highest transformation efficiency of 30.90%, surpassing values of 0.4 at 23.42% and 0.8 at 16.67%. Ultrasound treatment for 20 min demonstrated the highest transformation efficiency of 34.85%, while vacuum treatment for the same duration showed a similar trend at 36.29%. Moreover, exogenous addition of dithiothreitol exhibited efficiencies ranging from 31.42% to 41.44%, outperforming 5-azacytidine (36.02% to 37.14%).

Fig. 5
figure 5

Agrobacterium tumefaciens-mediated transient transfection efficiency. Various factors affecting transfection efficiency were explored, including infection time (15, 20, and 25 min), Agrobacterium concentration (OD values of 0.4, 0.6, and 0.8), ultrasound duration (15, 20, and 25 min), vacuum duration (15, 20, and 25 min), dithiothreitol (DTT) concentration (1, 2, and 3 mmol L−1), and 5-azactidine concentration (50, 100, and 150 μmol L−1). Transfection efficiency was assessed using 50 mg L−1 hygromycin-resistant callus. Different letters above bars represent a statistically significant difference at p < 0.05, according to Tukey’s test

Full size image

The Agrobacterium tumefaciens-mediated GUS gene transformation process is depicted in Fig. 6. Under the above optimal conditions, the rate of transformation efficiencies reached 42.42%. Among the 204 resistant callus tissues that were obtained, 103 resistant somatic embryos were further cultured, 61 of which progressed into resistant cotyledonary embryos and seedlings. Twenty-three resistant cotyledonary embryos were randomly selected for PCR identification, resulting in the detection of 15 positive embryos and seedlings (Fig. 7).

Fig. 6
figure 6

Agrobacterium tumefaciens-mediated genetic transformation process. The plasmid containing pCAMBIA1301-35SN-GUS was introduced into A. senticosus plants via Agrobacterium-mediated transformation. Transgenic seedlings of A. senticosus were successfully obtained via Agrobacterium-mediated somatic embryogenesis. A Leaves after Agrobacterium infection, B and C Hygromycin-resistant callus, D–F Hygromycin-resistant somatic embryos, G GUS staining of a non-genetically transformed cotyledon embryo, H GUS staining of a genetically transformed cotyledon embryo, I Hygromycin-resistant seedlings (one-month old)

Full size image
Fig. 7
figure 7

PCR of positive somatic embryos. The regenerated cotyledon embryos were identified by PCR method. PCR analysis was conducted using the following primer sequences (GUS gene): Forward (F): AACCACAAACCGTTCTACTTTACTG, Reverse (R): CAGAACATTACATTGACGCAGGT. The resulting PCR products were visualized by electrophoresis on a 1.0% (w/v) agarose gel. M 2 kb DNA Marker, 1 Positive control, 2 Negative control, 3–25 positive somatic embryos

Full size image

Discussion

Protoplasts can be isolated from various plant sources, including leaves, roots, stems, and callus. However, tailoring protocols for isolating and purifying protoplasts to each specific material are crucial because of the variability in cell wall composition across plant species, developmental stages, and tissues [23]. Cellulase concentration, macerozyme concentration, enzymolysis time, and centrifugal force are key factors that influence protoplast separation and purification [17, 20, 24]. In this study, embryogenic callus tissue that was obtained according to Yang’s report and is capable of regenerating plants through the somatic embryo pathway was used for protoplast isolation [19]. We observed that cellulase concentration had the most significant impact on protoplast separation yield, followed by enzymolysis time, macerozyme concentration, and centrifugal force. Optimizing these conditions enabled the yield of protoplasts to reach 1.88 × 106 cells per gram with a viability of 90%. Notably, this yield surpasses the only reported protoplast isolation from young leaves of A. senticosus, which yielded 2.22 × 105 cells per gram [25].

The embryonic callus of A. senticosus cultivated under dark culture conditions exhibits a consistently rapid propagation rate, as shown in Fig. 1H. This specific culture environment also leads to reduced chlorophyll content. Protoplasts derived from this callus source effectively minimize chloroplast autofluorescence, making them ideal for subcellular localization studies and providing sufficient quantities for transient gene expression analyses (Fig. 4).

PEG 4000-mediated protoplast genetic transformation is a widely employed method, and its success hinges on the concentration of PEG and the duration of transfection. Wang et al. observed superior results in grape protoplasts with 25% PEG 4000 for 30 min [26], while Adedeji et al. achieved optimal transfection in carnation protoplasts using 20% PEG 4000 for 15 min [24]. In our study, we found that 40% PEG 4000 for 40 min yielded the highest transformation efficiency in A. senticosus protoplasts. Previous research highlighted the effectiveness of heat shock treatment in enhancing transformation efficiency across various species. For example, Zakai et al. reported enhanced transformation efficiency in petunia protoplasts following a 45-minute heat shock treatment [27], while Fizree et al. observed peak efficiency in oil palm mesophyll protoplasts with a 90-second heat shock treatment [28]. In our study, a 25-minute heat shock led to the highest transformation efficiency, representing a 1.5-fold increase. By optimizing the transient transformation conditions as described above, we achieved an instantaneous transformation efficiency of 45.56% in protoplasts.

A stable genetic transformation system is vital for molecular breeding, yet research on transforming of A. senticosus is limited. Li et al. attempted Agrobacterium-mediated transformation with A. senticosus callus but could not generate complete plants [29]. Building on our somatic embryogenesis study [19], we obtained complete Agrobacterium-mediated transgenic plants of A. senticosus. Unlike the above-mentioned report [29], we found that both of them obtained resistant A. senticosus materials by using the Agrobacterium-mediated method, but their Agrobacterium strains and culture conditions of explants were all different, which may be the reason they could not achieve rooting plants. Therefore, optimizing the culture conditions and genetic transformation conditions of the explants is important. A comparison of our findings with those of Li et al. [29] notably shows that both studies aimed to obtain a transformed plant through Agrobacterium-mediated methods. However, the different strains of Agrobacterium, the source of the explants, and the in vitro culture conditions of the explants may be the reasons for the different results. Therefore, optimizing the explants and infection conditions is important to improve the efficiency of genetic transformation.

The concentration and duration of Agrobacterium infection are pivotal factors that influence the efficiency of explant conversion [27, 28, 30]. Suboptimal concentration can diminish effectiveness, while excessive concentration may harm the explants. Insufficient infection duration impedes T-DNA integration, while prolonged infection poses the risk of bacterial overgrowth and eventual death of the explants. To improve the transformation efficiency, we optimized the concentration OD value and infection time of Agrobacterium, achieving the highest efficiency with an OD600 of 0.6 and an infection duration of 20 min.

Ultrasound and vacuum treatment are also used to enhance genetic transformation efficiency. Qi et al. (2022) reported that sonication for 90 s and vacuum treatment for 10 min doubled the number of transformed adventitious buds per hypocotyl [30]. In this study, testing different vacuum durations (10, 15, and 20 min) and ultrasound durations determined that the 20-minute combination yielded the highest conversion efficiency. Moreover, adding low DTT and 5-azactidine concentrations further enhanced the transformation efficiency, which aligns with the genetic transformation of peanut [31]. However, the underlying mechanism needs to be explored further. In summary, with the use of these optimization techniques, transgenic seedlings of A. senticosus were successfully obtained via Agrobacterium-mediated somatic embryogenesis.

Conclusions

This study successfully established efficient protocols for isolating protoplasts and conducting transient transformations in A. senticosus, a medicinal woody plant. Under optimized conditions, protoplast yields reached 1.88 × 106 cells per gram with a viability of 90%, and the transient transfection rate peaked at 45.56%. In addition, Agrobacterium-mediated genetic transformation obtained GUS-positive seedlings through the somatic embryogenetic pathway. These breakthroughs lay the groundwork for future molecular biology investigations of A. senticosus, providing valuable resources for gene function exploration and genetic enhancement.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Huang LZ, Zhao HF, Huang BK, Zheng CJ, Peng W, Qin LP. Acanthopanax senticosus: review of botany, chemistry and pharmacology. Pharmazie. 2011;66(2):83–97.

    CAS  PubMed  Google Scholar 

  2. Jia AL, Zhang YH, Gao H, Zhang Z, Zhang YF, Wang Z, Zhang JM, Deng B, Qiu ZD, Fu CM. A review of A. senticosus (Rupr and Maxim.) harms: from ethnopharmacological use to modern application. J Ethnopharmacol. 2021;268: 113586.

    Article  CAS  PubMed  Google Scholar 

  3. Chen XQ, Jia XD, Yang S, Zhang GF, Li AL, Du P, Liu LB, Li C. Optimization of ultrasonic-assisted extraction of flavonoids, polysaccharides, and eleutherosides from Acanthopanax senticosus using response surface methodology in development of health wine. LWT. 2022;165: 113725.

    Article  CAS  Google Scholar 

  4. Gao ZY, Zha F, Zhang JY, Zhong QQ, Tian HF, Guo XJ. Simultaneous extraction of Saponin and Polysaccharide from Acanthopanax senticosus fruits with three-component deep eutectic solvent and the extraction mechanism analysis. J Mol Liq. 2024;396: 123977.

    Article  CAS  Google Scholar 

  5. Zhang J, Zhang CY, Xue HD, Lu CB, Rong R, Li JJ, Zhou SJ. Purification effect of PES-C ultrafiltration membrane incorporated with emodin on Acanthopanax senticosus injection. Pharmaceuticals. 2023;16(8):1135.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Zhang ZC, Wu YH, Shi D, Jiang CY, Cao HY, Jiang FY, Bao XM, Shen Y, Shi X. Acanthopanax senticosus improves cognitive impairment in Alzheimer’s disease by promoting the phosphorylation of the MAPK signaling pathway. Front Immuno. 2024;15:1383464.

    Article  CAS  Google Scholar 

  7. Zhao Y, Liu GZ, Yang F, Liang YL, Gao QQ, Xiang CF, Li X, Yang R, Zhang GH, Jiang HF, Yu L, Yang SH. Multilayered regulation of secondary metabolism in medicinal plants. Mol Hortic. 2023;3:11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Chen XY, Martin C, Chen WS. Medicinal plant biology: a new era for medicinal plant research. Med Plant Biol. 2022;1(1):1–1.

    Google Scholar 

  9. Bull T, Khakhar A. Design principles for synthetic control systems to engineer plants. Plant Cell Rep. 2023;42:1875–89.

    Article  CAS  PubMed  Google Scholar 

  10. Meng F, Ellis T. The second decade of synthetic biology: 2010–2020. Nat Commun. 2020;11:5174.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Bapat VA, Jagtap UB, Suprasanna P. Medicinal phytometabolites synthesis using yeast bioengineering platform. Nucleus. 2022;65:391–7.

    Article  Google Scholar 

  12. Wang PP, Wei W, Ye W, Li XD, Zhao WF, Yang CS, Li CJ, Yan X, Zhou ZH. Synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae cell factory at high-efficiency. Cell Discov. 2019;5(1):1–14.

    Article  Google Scholar 

  13. Martin VJ, Pitera DJ, Withers ST, Newman JD, Keasling JD. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat Biotechnol. 2003;21:796–802.

    Article  CAS  PubMed  Google Scholar 

  14. Srinivasan P, Smolke CD. Engineering a microbial biosynthesis platform for de novo production of tropane alkaloids. Nat Commun. 2019;10:3634.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Leonard O, Mucha TH, Phon B, Pfeifer G. Stephanopoulos isoprenoid pathway optimization for taxol precursor overproduction in Escherichia coli. Sci. 2010;330:70–4.

    Article  Google Scholar 

  16. Reyna-Llorens I, Ferro-Costa M, Burgess SJ. Plant protoplasts in the age of synthetic biology. J Ex Bot. 2023;13:3821–32.

    Article  Google Scholar 

  17. Sun B, Zhang F, Xiao N, Jiang M, Yuan Q, Xue SL, Miao HY, Chen Q, Li MY, Wang XR, Wang QM, Tang HR. An efficient mesophyll protoplast isolation, purification and PEG-mediated transient gene expression for subcellular localization in Chinese kale. Sci Hortic. 2018;241:187–93.

    Article  CAS  Google Scholar 

  18. Guo MF, Ye JY, Gao DW, Xu N, Yang J. Agrobacterium-mediated horizontal gene transfer: mechanism, biotechnological application, potential risk and forestalling strategy. Biotechnol Adv. 2019;37(1):259–70.

    Article  CAS  PubMed  Google Scholar 

  19. Yang Y, You XL, Tao L. Rapid propagation of Eleutherococcus senticosus via somatic embryogenesis. J Northeast Fores Univ. 2012;40(10):19–21.

    CAS  Google Scholar 

  20. Shen JB, Fu JX, Ma J, Wang XF, Gao CJ, Zhuang CX, Wan JM, Jiang LW. Isolation, culture, and transient transformation of plant protoplasts. CPCB. 2014;63:2.8.1-17.

    Google Scholar 

  21. Fan GZ, Nie TT, Huang YT, Zhan YG. GSNOR deficiency enhances betulin production in Betula platyphylla. Trees. 2018;32:847–53.

    Article  CAS  Google Scholar 

  22. Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987;6:3901–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Hoffmann N, King S, Samuels AL, McFarlane HE. Subcellular coordination of plant cell wall synthesis. Dev Cell. 2021;56(7):933–48.

    Article  CAS  PubMed  Google Scholar 

  24. Adedeji OS, Naing AH, Kang H, Chung MY, Lim KB, Kim CK. Optimization of protocol for efficient protoplast isolation and transient gene expression in carnation. Sci Hortic. 2022;299: 111057.

    Article  CAS  Google Scholar 

  25. Xing ZB, Shen HL, Zhao XY, Liu Y, Huang J, Fan SH. Method for isolation of protoplast from young leaves of Eleutherococcus senticosus (Rupr. Et Maxim) Harms. Plant Physiol Commun. 2006;42(2):288–90.

    CAS  Google Scholar 

  26. Wang HL, Wang W, Zhan JC, Huang WD, Xu HY. An efficient PEG-mediated transient gene expression system in grape protoplasts and its application in subcellular localization studies of flavonoids biosynthesis enzymes. Sci Hortic. 2015;191:82–9.

    Article  CAS  Google Scholar 

  27. Zakai N, Ballas N, Hershkovitz M, Broido S, Ram R, Loyter A. Transient gene expression of foreign genes in preheated protoplasts: stimulation of expression of transfected genes lacking heat shock elements. Plant Mol Biol. 1993;21:823–34.

    Article  CAS  PubMed  Google Scholar 

  28. Fizree MPMA, Masani MYA, Shaharuddin NA, Ho CL, Abd Manaf MA, Parveez GKA. Efficient PEG-mediated transformation of oil palm mesophyll protoplasts and its application in functional analysis of oil palm promoters. S Afr J Bot. 2023;155:1–9.

    Article  Google Scholar 

  29. Li XB, Jin B, Chen GR. Study on genetic transformation of Acanthopanax senticosus. J Cent China Norm Univ. 1995;04:494–7.

    Google Scholar 

  30. Qi FH, Tang MH, Wang WX, Liu L, Cao Y, Jing TZ, Zhan YG. In vitro adventitious shoot regeneration system for Agrobacterium-mediated genetic transformation of Fraxinus mandshurica Rupr. Trees. 2022;36:1387–99.

    Article  CAS  Google Scholar 

  31. Zhu J, Han SY, Yuan M, He LQ, He GH, Huang JQ. Optimization of Agrobacterium tumefaciens-mediated transformation in Peanut. Chinese J Oil Crop Sci. 2018;40(02):191–8.

    Google Scholar 

Download references

Funding

This work was supported by the Seed Industry Innovation Project of Heilongjiang Province, (ZQTYB231700002) and the Fundamental Research Funds for the Central Universities (2572023CT11-02).

Author information

Authors and Affiliations

  1. Key Laboratory of Saline-Alkali Vegetation Ecology Restoration, Ministry of Education, Northeast Forestry University, Harbin, 150040, China

    Huan Liu, Panpan Sun, Yaqian Tong, Xinglei Gao & Guizhi Fan

  2. College of Chemistry, Chemical Engineering and Resource Utilization, Northeast Forestry University, Harbin, 150040, China

    Zhonghua Tang

Authors
  1. Huan Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Panpan Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yaqian Tong
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xinglei Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Zhonghua Tang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Guizhi Fan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Gui-Zhi Fan and Zhong-Hua Tang conceived and designed the experiments. Xing-Lei Gao and Ya-Qian Tong performed the research. Huan Liu and Pan-Pan Sun analyzed the data and wrote the paper. All authors reviewed the manuscript.

Corresponding author

Correspondence to Guizhi Fan.

Ethics declarations

Ethics approval and consent to participate

This manuscript is an original paper and has not been published in other journals. The authors agreed to keep the copyright rule.

Consent for publication

The authors agreed to the publication of the manuscript in this journal.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Liu, H., Sun, P., Tong, Y. et al. Establishment of transient and stable gene transformation systems in medicinal woody plant Acanthopanax senticosus. Chem. Biol. Technol. Agric. 11, 142 (2024). https://doi.org/10.1186/s40538-024-00669-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40538-024-00669-8

Keywords