Skip to main content
Chemical and Biological Technologies in Agriculture
Download PDF
Download ePub

New finding of Trichoderma asperellum in decreasing soil N2O emission

Chemical and Biological Technologies in Agriculture volume 9, Article number: 77 (2022) Cite this article

Abstract

Background

Global warming caused by greenhouse gas emissions affects sustainable human development. Agricultural practices are important source of greenhouse gases (GHG). Nitrous oxide (N2O) contributes greatly to farming GHG. It is important to find a potential and practical biological technique that mitigate N2O emissions in an environment friendly way.

Methods

N2O-inhibiting fungi were isolated and identified in the lab. The fungi were added into the soil and placed in the incubator and interval gas sampling was analyzed by gas chromatograph.

Results

Fungus coding Z17 was identified molecularly with the same evolutionary branch on the phylogenetic tree with Trichoderma asperellum by BLAST comparison on NCBI GenBank. In the lab simulation, the N2O emission flux was decreased by 28.18–47.16% by inoculating Trichoderma asperellum with 106 cfu·g−1, 5 × 106 cfu·g−1 and 107 cfu·g−1 fungal spores in the soil compared to the control.

Conclusions

The N2O-inhibiting fungus Z17 was identified as Trichoderma asperellum, capable of suppressing N2O emissions from soil with at least 106 CFU·g−1 soil. The best N2O-inhibiting effect was on day 9 of inoculation into soil because most of the fungal numbers were present in soil.

Graphical Abstract

Background

An increase in the world’s population requires many more food and other products, resulting in much pressure on the agricultural sector and a rise in the utilization of chemical fertilizers and pesticides that are responsible for increasing environmental pollution and global warming. In recent years, food security has been threatened by population explosion due to lack of agricultural land [1]. Therefore, it has become a challenge to enhance the crop productivity to feed the population. Intensive use of chemical fertilizers resulted in the deterioration of both human health and environment. Consequently, to overcome the adverse effects of agrochemicals on our environment, there has been a shift towards organic fertilizers or other substitutes, which are eco-friendly and help to maintain a sustainable environment [2]. Global warming is one of the major threats to human survival and social development. Agriculture is an important source of GHG emissions globally due to its direct contribution to methane (CH4) and nitrous oxide (N2O) emissions [3], the largest source of atmospheric N2O with about 298–300 times more global warming potential than CO2, and are the most significant ozone-depleting substance of the twenty-first century [4], contributing approximately 6% to the observed climate change [5, 6], agricultural soils accounting for 60% of human-derived N2O emissions [7].

Nitrogen (N) fertilizer is the major driver of N2O emissions in agricultural soil [8]. Agricultural N2O emissions are strongly correlated with the amount of chemical N fertilizer applied, that globally has increased eightfold over the last century, including a doubling in South Asia since 1990 [9]. Increased N2O increases risks to global warming [10], the largest remaining threat to the stratospheric ozone layer [4]. N2O emissions are rising at a rate of 0.2–0.3% annually [10, 11]. Agricultural soil microbial activity is driving N2O production [12], that is widely recognized as a major source of N2O, while annual 4 Tg of the total N2O emission from N fertilizer in croplands was reported [13].

Traditionally, reduction of N fertilizer, water management, chemical urease inhibitors (N-serve (nitrapyrin), dicyandiamide (DCD), AM (2-amino-4 chloro-6 methylpyrimidine), sodium chlorate, sodium azide, and benzene hexachloride [14] were used to reduce the N2O emissions. However, farmers would not like to reduce N fertilizer because they feared loss of grain yield. Soil sustainability is vital for enhanced nutrient turnover and optimal agricultural productivity. Application of chemical urease inhibitors would lead to potential environmental pollution. It is necessary to mitigate N2O emissions from agricultural activities and agricultural ecosystems by developing practical N2O mitigation strategies that can combat global climate changes [6, 15]. The development and verification of practical N2O mitigation strategies, for example, enhancing N use efficiency and novel technologies (environmental effect factors (EEFs), precision agriculture, biological nitrification inhibition (BNI), N2O reducing soil bacteria) [6], are required. Reducing N use [16, 17], application of biochar amendments [8, 17,18,19,20], co-application of biochar and electric potential [21], pelleted poultry manure with Azoarcus, Niastella, and Burkholderia [22], some plants such as cruciferous species[20], Hyparrhenia diplandra [23], Megathyrsus maximus [24], Picea abies and Abies nordmanniana [25], nitrification and urease inhibitors [26], nitrification inhibitor chlorinated pyridine (CP), 2-chloro-6-(trichloromethyl)-pyridine (Nitrapyrin, NP) and DMPSA and drip-fertigation [27,28,29] were used to mitigate N2O emissions from agricultural soil.

We have conducted many investigations on antagonistic microbe–pathogen interactions over 20 years. Over 60 species of antagonistic microbes against watermelon, cucumber and other vegetable and melons’ disease have been isolated and identified and stored at our lab. Microbe-based biofertilizers may contribute substantially to the soil health, fertility status and microbial biomass. These microbe-based fertilizers help to increase the nutrient solubilization/mobilization (N, P, and K), hydrogen cyanide (HCN) production, pathogen control and induced systematic resistance, etc. Moreover, the application of compost-based biofertilizers also helps to increase the production of phytohormones, siderophore, vitamins, protective enzymes, antibiotics, etc. We were enlightened by such microbial antagonism and imagined whether there will be some inhibitory effect of these antagonistic microbes on nitrifier or denitrifier consequently leading to a reduction of N2O emission from soil. So we began the investigation of microbial inhibition of N2O emission from soil. We proposed the hypothesis as follows: (1) fungi can suppress N2O emissions from the soil by inhibiting nitrifier activities, and (2) fungi can inhibit the growth of crop pathogens in the soil to protect the crop from disease to decrease the production and application of chemical fertilizers and pesticides. The aims were to explore the possibility of microbes inhibiting N2O emissions from the soil. Soil microbes were isolated and identified in the present work to screen and develop some potential N2O-inhibiting fungi for application in agricultural carbon neutralization and sustainability.

Materials and methods

Microbial sources

Fungi numbered Z3, Z6, Z8, Z9, Z11, Z13, Z14, Z15, Z16, and Z17 were isolated from different watermelon field soils (different species of watermelon, region and greenhouse cultivation and traditional cultivation) while screening antagonist microbes and stored in our lab 8 years ago.

Soil collected and processed

The soil for this experiment was collected from an agricultural field at a depth of 20 cm from the Agricultural Meteorological Experimental Station, Nanjing University of Information Science and Technology China, June 2015. The soil’s physical–chemical properties are listed in Table 1. The soil microbial composition was 2.6 × 108 CFU·g−1 of bacteria, 4.1 × 106 CFU·g−1 of actinomycetes and 3.7 × 104 CFU·g−1 of fungi.

Table 1 Physical–chemical properties of tested soil
Full size table

The soil was wind-dried for 20 days and ground to pass through a 60-mesh sieve. A total of 2.5 kg of 60 mess soil was added to 5 L of a glass bottle (soil culture apparatus made by ourselves) to investigate N2O emission and the fungal inhibiting effect on N2O.

Preparation of microbial culture media

LB (Luria broth) culture medium: casein peptone 1.0 g, yeast extract 0.5 g and NaCl 1.0 g were added in 100 mL distilled water to maintain pH 7.4

PDA (potato dextrose agar) medium: potato chip 2.0 g, dextrin 0.2 g were added in 100 mL distilled water while maintaining natural pH value. The potato was peeled and cut into small chips to boil for 30 min. The boiled potato chips were filtered with cotton gauze. Add distilled water to 100 mL. Agar (1.8 g) was added to the potato filtrate, sterilized for 30 min at 114 °C and cooled for storage.

Preparation of fungal suspension

The fungi numbered Z3, Z6, Z8, Z9, Z11, Z13, Z14, Z15, Z16, Z17 were inoculated in a culture dish to activate at 28 °C in an incubator for 6 days. After 6th day of culture in the dish, a fungal colony plug with a diameter of 5 mm was taken from the plates to inoculate the fungal liquid media in a conical flask, which was cultured at 28 °C and 170 rpm in a shaking flask incubator for 4 days. The culture broth was filtered with 4 layers of cotton gauze, and the liquid was collected after 96 h of culture. The filtrate was centrifuged at 8000 r·min−1 for 10 min to collect fungal mycelium and spores. The collected fungal mycelium and spores were re-suspended in sterile water. The re-suspended spores were counted with a hemocytometer to prepare a series of concentrations of spore suspension.

N2O-inhibiting fungal screening, identification, and confirmation

We prepared the screening equipment ourselves (Fig. 1). A total of 2.5 kg of soil was added to the soil incubator to culture fungi at 28 °C for 7 days in the lab. Fungi were inoculated into the soil to check whether N2O formation and emission from the apparatus were inhibited by fungi. The screening experimental design is shown in Table 2.

Fig. 1
figure 1

Lab soil culture apparatus. 1 Rubber stopper, 2 seal clamp, 3 thermometer, 4 rubber tube, 5 T-type valve, 6 soil

Full size image
Table 2 Different treatments of preliminary screening of N2O-inhibiting fungi
Full size table

The potential N2O-inhibiting fungi in the first-round experiment was further verified a second time to examine the actual capability of the preliminary N2O-inhibiting fungi as indicated in Table 3. The apparatus was incubated at 28 °C in the lab with 3 replicates for each treatment.

Table 3 Experimental design of second screening of N2O-inhibiting fungi
Full size table

The fungi from the second screening were verified a third time, as listed in Table 4. A total of 106 cfu·g−1, 5 × 106 cfu·g−1, and 107 cfu·g−1 soil fungal spores were inoculated into the soil for further culture to select the best N2O-inhibiting fungus. The culture apparatus was incubated at 28C in the lab with 3 replicates for each treatment.

Table 4 Experimental design of the third screening of N2O-inhibiting fungi
Full size table

The best N2O-inhibiting fungi were cultured on plates for morphological and molecular identification. The fungus was grown on an agar plate for 7 days. The fungal colony and mycelial morphology were observed microscopically. Fungal mycelium and spores were scraped and added to a 1.5-mL centrifuge tube. The cell lysis digestion liquid was added to the tube to dissociate the cell wall and nuclear envelope to release DNA.

The total DNA of the fungus was extracted with an OMEGA soil DNA extraction kit (E.A.N.A. Fungal DNA Mini kit).

The fungal PCR 18S rDNA was conducted with primers ITS4: 5′­TCCTCCGCTTATTGATATGC­3′, ITS: 5′-GGAAGTAAAAGTCGTAACAAGG­3′. PCR reaction system consisted of 0.5 μL of ITS4 primer, 0.5 μL of ITS5 primer, 10 × PCR Buffer (Mg2+) 2.0 μL, Mg2+ 1.5 μL, DNA template 2.0 μL, Taq polymerase (2.5 U. μL −1) 0.5 μL, ddH2O 12.0 μL. Total volume 20.0 μL, PCR reaction conditions: 94 ℃ pre-denaturing 2 min, 94 ℃ denaturing 30 s, 52℃ annealing 30 s, 72 ℃ elongation 1 min, 30 cycles, 72 ℃ elongation 10 min. 10 storage. A 1% agarose gel electrophoresis was used to check the purity of PCR products.

The PCR products were purified with a DNA purification kit (AxyPrep PCR Cleanup kit, Axygen) based on the manufacturer’s instructions.

Ten microliters of purified PCR product was sent to Nanjing Jinsirui Biotechnology Company Ltd. for sequencing.

The sequence was submitted to NCBI GenBank online to BLAST and compare 99% of the sequence homology with other known microbes in GenBank. Subsequently, the best N2O-inhibiting fungus was identified based on DNA sequence homology. The fungal phylogenetic tree was constructed with Mega 3.0.

Real-time quantitative PCR (qPCR) qualifying the number of N2O-inhibiting fungus in soil after inoculation

The best N2O-inhibiting fungus Z17 was cultured on plates for qPCR to identify the number of soil [30]. The fungus was grown on an agar plate for 7 days. Fungal mycelium and spores were scraped and added to a 1.5-mL centrifuge tube. The cell lysis digestion liquid was added to the tube to dissociate the cell wall and nuclear envelope to release DNA.

The total DNA of the fungus was extracted with an OMEGA soil DNA extraction kit (E.A.N.A. Fungal DNA Mini kit) after day 9, 18, 24 and 30 inoculated in soil.

The fungal PCR 18S rDNA was conducted with primers ITS1F: 5′­CCAAACTCTTTCTG-3′, ITS1R: 5′-GCATTTCGCTGCGTTCTT­3′. qPCR reaction system consisted of 1 μL of ITS1F primer (10 μmol/L), 1μL of ITS1R primer, SYBR Premix Ex Taq (2×)12. 5 μL, DNA template 1.0 μL, ddH2O 9.5 μL. Total volume 25.0 μL, qPCR reaction conditions: 95 ℃ pre-denaturing 10 s, 95℃ denaturing 15 s, 60 ℃ annealing 15 s, 72 ℃ elongation 30 s, 45 cycles, 55 ℃ elongation 10 s. The reaction temperature was increased from 55 ℃ to 95 ℃ at a speed of 0.1 ℃/s. Fluorescence signal was detected one time every temperature-rising of 0.5 ℃ to conduct melting curve analysis. Standard curve was drawn on the basis of X-axis of logarithm of standard plasmid DNA VS Y-axis of reaction cycle (Ct). Sample concentration and gene copy were computed as formula: detected sample DNA concentration (ng/μL) = OD260 × 50 × dilution times. Sample DNA molecular weight = base number × 324. Detected sample DNA copy number = (detected sample DNA concentration/sample DNA molecular weight) × 6 × 1014.

Preparation of the apparatus for soil greenhouse gas generation and collection

The soil culture apparatus was designed and made with a large glass bottle of 5 L. The apparatus shown in Fig. 1 comprises gas emission, pumping, and collecting. The soil was added to the bottle, and the fungal spore suspensions were inoculated into the soil to monitor the N2O-inhibiting effect. A plug (diameter of 5 mm) of the best N2O-inhibiting fungal colony was inoculated into 5 mL of liquid PDA medium at 28 °C and 170 rpm in a shaking flask at logarithmic stage. The broth was centrifuged to collect fungal spores. The centrifugal sediments were added to distilled water to dilute a series of concentrations of fungal spore suspensions. The spore suspension was quantified and added to the soil and mixed. The apparatus was placed in a constant temperature room. Gas was sampled from the sampling valve to determine the N2O concentration by gas chromatograph (GC) (Agilent 7890A).

Soil, water, and fungal suspensions were added to the bottles and blended thoroughly when the experiment was started. The airproof of the rubber stopper of the bottle was checked with water. The apparatus was put in the lab to culture. All valves of the tubes were opened to freely maintain air ventilation. The valves of the hoses and tubes were closed to enrich the N2O concentration before 20 min of sampling gas.

Sampling gases began from the third day after the soil and fungi were blended in the bottle. The gas sample was collected from 9:00 in the morning and 15:00 in the afternoon once after every 3 days. Valves were switched off to concentrate N2O inside the bottle before 20 min of sampling. A 20-mL injector was connected to a T-type valve to make the injector connect to the bottle. Initially, the bottles were pumped in and out 4 times to mix the bottle gases fully, and then the gas sample was collected. One gas sample was collected after every 80 min. Consequently, 3 samplings were conducted for one bottle at one time. After finishing gas sampling, the valves were opened. The air temperature inside the bottle was recorded.

Gas N2O was analyzed by GC (Agilent 7890A). The GC analysis parameters included an ECD detector, 300 °C detection temperature, a chromatography column of SS-1 m × 2 mm × PorapakQ (80/100), SS-3 m × 2 mm × PorapakQ (80/100), a chromatography column temperature of 50 °C, a carrier gas of pure dinitrogen gas, a flow rate of 25 cm3·min−1, a retention time of 3.35 min, and a standard N2O gas of 320 ppb made by the Nanjing Shangyuan industrial gas factory.

N2O emission flux calculation

N2O emission flux was calculated by the formula: \(F = 60 \times \rho \cdot (V/m) \cdot (dc/dt) \cdot 273/(273 + T)\), where F indicates N2O flux emitted from soil (μg·kg−1·h−1), ρ indicates the density of N2O at standard state (1.25 kg·m−3), V shows effective space volume of culture bottle (m3), m indicates soil quality inside the bottle (kg), dc/dt demonstrates N2O emission rate (ppb·min−1), and T indicates the average air temperature inside the bottle during gas sampling (℃) [31].

N2O emission flux was expressed as the means of three replicates plus the standard deviation for each treatment.

Data processing and analysis

Microsoft Excel 2010 was used to calculate the data. Origin2018 was used to draw data figures and AUTOCAD2010 was used to draw apparatus picture. SPSS 19.0 was used to carry out significance difference and correlation analyses. Analysis of variance (ANOVA) was used to conduct variance analysis at a 95% confidence level, and least significant difference (LSD) was used for multi-comparison among treatments.

Results

Preliminary identification of N2O-inhibiting fungi

In the present experiment, several fungi were found to have the capacity to suppress N2O generation and emission. The N2O flux was reduced in the Z3, Z8, Z11, Z14, and Z17 treatments relative to the CK treatment during the sampling duration. Compared with CK, the N2O emissions in the Z3, Z8, Z11, Z14, and Z17 treatments decreased by 18.54%, 19.15%, 9.53%, 28.0%, and 38.22%, respectively, among which the greatest reduction was 38.22% for Z17. Initially, a decreasing tendency of N2O emissions was observed. It was determined that nitrification inhibitors in the soil may grow quickly due to PDA culture, possibly resulting in the decrease in N2O emissions in all treatments. This result indicated that Z17 was the best N2O-inhibiting fungus (Fig. 2). On day 9, N2O emission was the lowest, while it was gradually higher after day 9. Of course, the N2O emission for all treatments was lower than CK. It was suggested that the best effect of N2O-suppression was observed after inoculation on day 9 that indicate optimal conditions suitable for the growth of fungus.

Fig. 2
figure 2

Preliminary screening of N2O-inhibiting fungi and N2O emission. CKZ-check, without fungi, Z3, Z8, Z11, Z14, Z17-addition of 50 mL fungal suspension of Z3, Z8, Z11, Z14, Z17, respectively

Full size image

Second screening of N2O-inhibiting fungi

N2O emissions in the Z3, Z8, Z11, Z14, and Z17 treatments were significantly suppressed, and the Z17 treatment had the best inhibitory effect on N2O emissions (Fig. 3). The N2O emission flux declined by 14.58%, 13.86%, 12.41%, 17.71%, and 25.16% compared to CK. This tendency complied with the preliminary experimental result. The greatest decrease in N2O by the fungus was observed for Z17, demonstrating that Z17 was the best N2O-inhibiting fungus. On day 9, the N2O emission was the lowest, while it was gradually higher after day 9. Of course, the N2O emission for all treatments was lower than CK. It was suggested that the best effect of N2O-suppressing was on day 9 of inoculation when there would be optimal conditions suitable for the fungus.

Fig. 3
figure 3

Second screening of N2O-inhibiting fungi and N2O. CKZ-check, 0 cfu·g−1 of inoculum, the inoculum amount of Z3, Z8, Z11, Z14, Z17 was 106 cfu·g−1

Full size image

Third time identification and confirmation of the best N2O-inhibiting fungus, Z17

To investigate the actual capacity of N2O-inhibiting fungus Z17, 3 inoculation concentrations of 106 cfu·g−1, 5 × 106 cfu·g−1, and 107 cfu·g−1 fungal spores were used to incubate precisely in the lab based on the second time test. The N2O emissions from the Z17 treatment in the whole test period were much lower than those from the CKZ treatment (control). Initially, the difference was not as significant among the different inoculating concentrations of Z17, while a significant difference was found with increasing culture duration. The N2O emissions in treatments Z17-1, Z17-2, and Z17-3 were reduced by 28.18%, 32.79%, and 47.16%, respectively, compared with CKZ (control) (Fig. 4). Z17 significantly suppressed N2O emissions from the soil. The greater the Z17 addition, the lower the N2O emissions. The inhibitory effect of Z17 on N2O emission was the best. When the inoculant of Z17 reached 107 cfu.g−1, the best N2O-inhibition effect was obtained. On day 9, the N2O emission was the lowest, while it was gradually higher after day 9. Of course, the N2O emission for all treatments was lower than CK. It contributed to a decrease of Z17 number of DNA copy by qPCR colonized in soil gradually depending on time. The gene copies in soil on day 9 were 3.724 × 103 ng/g, while the DNA copies on days 18, 24, 30 were 3.026 × 103 ng/g, 2.583 × 103 ng/g, 2.149 × 103 ng/g (Fig. 5). It was suggested that the best effect of N2O-suppressing was on day 9 of inoculation where the number of soil Z17 was found the most.

Fig. 4
figure 4

Third screening of N2O-inhibiting fungi Z17 at different inoculant gradients and N2O. Note: CKZ-check, inoculation of 0 cfu·g−1, Z3, Z8, Z11, Z14, Z17 inoculation of 106 cfu·g−1, 5 × 106 cfu·g−1, 107 cfu·g−1

Full size image
Fig. 5
figure 5

The fungal DNA copies in the soil in the third time screening of N2O-inhibiting fungus Z17 at different inoculant gradient and N2O

Full size image

Morphological and molecular identification of N2O-inhibiting Z17

The N2O-inhibiting fungus Z17 was grown on PDA slowly in the dark. The mycelium was initially white and gradually became gray-green, while green spores stretched from the center to the dish margin to form layers of concentric circles. Z17 colonies on plates are shown in Fig. 6. Conidiophores had a much-branched hierarchy, with many swollen peduncles in the middle affiliated with the ends of branches, namely, spore-producing cells. The view of plate colony morphology (up Fig. 6), spore (middle Fig. 6), and microscopic vision of conidiophore, mycelium, and spores (down Fig. 6).

Fig. 6
figure 6

Morphological characteristics of Z17 colonies on a plate and microscopic observation of conidiophores, mycelia and spores (× 800)

Full size image

Approximately 700 bp of the DNA fragment of 18S rDNA (ITS4/ITS5) PCR product of Z17 was obtained after 1% agarose gel imaging. Based on the DNA sequence, homologically identical partner was searched in NCBI GenBank. For this purpose, Blastn was used to identify the closely related organism using 18S rDNA gene sequence. In the GenBank database the 18S rDNA gene sequence was deposited under accession number and a phylogenetic tree was constructed through neighbor-joining (Fig. 7). Strain Z17 was placed on the same evolutionary branch as the fungus Trichoderma asperellum (No. KM456217.1) on the phylogenetic tree with 99% homology. Finally, Z17 was identified as Trichoderma asperellum.

Fig. 7
figure 7

Phylogenetic tree of strain Z17 related to Trichoderma sp

Full size image

Discussion

Nitrous oxide, global environmental change, and agriculture

Agriculture plays a major role in production of nitrous N2O. More than two-thirds of global N2O emissions originate from soil, and the main sources of N2O are N fertilizers, urine and dung deposition during grazing, and manure application onto grasslands [26]. Nowadays, huge amount of organic waste is being generated by farm operations due to the disposal difficulties posing serious threats to the environment, human population and soil fertility. Globally, 3.3 Tg N2O-N per year is emitted from fertilized croplands due to the use of N fertilizer and animal manure [26].

The global nitrogen fertilizer application rate is getting double at a rate of 3.0 × 108 t per year [32], and the annual nitrogen loss is 6.15 × 107 t due to the loss of nitrate-nitrogen from agricultural systems [33]. An increase in the risk of nitrogen loss from agricultural ecosystems and environmental pollution problems will be warned [17]. Much more N2O will be emitted from the soil. Agricultural cleaner production and carbon neutralization are urgently required. Hence, there is a need to develop a sustainable agriculture system with enhanced soil fertility and least ecological threat. As substitute fertilizers, microbe-based biofertilizers are sustainable, cost-effective and eco-friendly.

N2O inhibition and cleaner production approaches in agriculture

Biochar has attracted many scientists focusing on mitigating N2O emissions from the soil since the twenty-first century. Biochar not only mitigates soil N2O emissions, but also ameliorates soil and stimulates crop growth. Presently, biochar has been a research hot spot. Biochar amendment has been recommended as a potential strategy to mitigate N2O and NO emissions for crop production [27, 34].

However, the cost of biochar production and application is so expensive that it is difficult for use in agriculture. The second pollution during the production and application of these chemical inhibitors was given little consideration. N2O emission mitigation was obtained by modifying soil conditions, such as improving drainage and reducing compaction, which are adverse to denitrification [35].

Most considerations of chemical inhibitors to inhibit N2O-related enzymes were given. Less attention has been paid to plants modifying nitrification in situ, such as Brachiaria humidicola, a tropical grass species, inhibiting the Nitrosomonas europaea strain (nitrifying bacteria) by exuding active chemicals during nitrification. However, how and what triggers or molecularly controls biological nitrous oxide inhibitor production are unknown [33].

Some plants capable of suppressing nitrification, such as Hyparrhenia diplandra [23], Picea abies and Abies nordmanniana [18], Megathyrsus maximus [24], Lolium perenne, Melinis minutiflora, Arachis hypogaea, Panicum maximum [32], Andropogon gayanus [32, 36], Leymus racemosus [37], Periandra mediterranea [38], and Moringa oleifera [39], have been reported [17]. Some chemically organic active substances excreted from plants are capable of suppressing nitrification [17], for example, kuanjin extracted from the seeds of Pongamia glabra [40], oil from Mentha spicata [41,42,43], nimin oil from the seeds of Azadirachta indica [44], gallocatechin and catechin from the degradation of Arbutus unedo leaves [45]. Among them, phenolic compounds and terpenoids have been investigated with the capability of nitrification inhibition [17]. These active chemicals from plant secretion or degradation were referred to as the BNI concept by Japanese scientists [37], which is also called a “natural nitrification inhibitor” [14].

N2O-inhibiting microbes

N2O-inhibiting microbes could be used to mitigate soil N2O emissions to reach agricultural carbon neutralization. In the current study, Z17 was identified as a fungus that effectively inhibited N2O emissions from agricultural soil. Approximately half of N2O was reduced by this magic tiny organism compared to that in a 2-month lab simulation; in other words, a reduction of 1.6 Tg N2O per year is expected globally if the fungus is applied in agriculture worldwide. This will provide a novel thought and technological tool for agricultural carbon neutralization. However, based on results, on day 9, the N2O emission was the lowest, while it was gradually higher after day 9. Of course, the N2O emission for all treatments was lower than CK. It was ascribed to the decreased fungal number in soil. It suggested that the best effect of N2O-suppressing was on day 9 of inoculation when there would be optimal conditions suitable for the fungus. Surely, many questions have to be further investigated whether this potential fungus could be produced and applied to agricultural carbon neutralization in the next step.

In the present work, Z17 was identified as Trichoderma asperellum, with reproductive mycelium, spore, and green colonies on PDA. The mycelium and spores tolerated stress and could survive in the soil for a long time. Trichoderma asperellum modulates defense genes and potentiates gas exchanges in upland rice plants and is a stable combination for a multiple function biological agent [46]. Trichoderma spp. is a universal saprotrophic fungus in terrestrial ecosystems, and as rhizosphere inhabitants, they mediate interactions with other soil microorganisms, plants, and arthropods at multiple trophic levels. In the rhizosphere, Trichoderma can reduce the abundance of phytopathogenic microorganisms, which involves the action of potent inhibitory molecules, such as gliovirin and siderophores, whereas endophytic associations between Trichoderma and the seeds and roots of host plants can result in enhanced plant growth and crop productivity, as well as the alleviation of abiotic stress. Such beneficial effects are mediated via the activation of endogenous mechanisms controlled by phytohormones such as auxins and abscisic acid, as well as by alterations in host plant metabolism [47].

Trichoderma can be fermented to make organic fertilizer with animal dung to apply to the soil, where the bio-organic fertilizer not only supports nutrients for crop growth and protects plants from the pathogen, as a well-known effective antagonist agent, but also improves soil quality and further mitigates N2O emission from soil [48]. The ideal mixture of soil and organic compounds with Bacillus sp. and Trichoderma asperellum inoculations stimulated optimal growth and provided nutrient content to banana seedlings [49, 50]. Trichoderma-enriched biofertilizer reduces the application of chemical fertilizers and therefore can be considered a noble practice in sustainable agriculture. It is helpful for cleaner agricultural production [48]. These fertilizers are developed by adding the characterized plant growth-promoting bacterial or fungal strains in compost produced from agricultural waste. The microbial strains with known plant-beneficial role and ability to survive and thrive in compost can be used to produce such biofertilizers.

Further investigation of the effects of environmental factors on Trichoderma asperellum growth, reproduction, and best application conditions should be conducted. Thoroughly exploring the N2O-inhibiting mechanism of Trichoderma asperellum, physiological active components, and regulatory functional genes will be very beneficial to agricultural carbon emission reduction and sustainable development. Hopefully, the N2O-inhibiting functional gene of Trichoderma asperellum will be cloned and sequenced for recombination and transfer to plants to mitigate soil N2O emissions.

Comparison of present nitrification inhibitors

In comparison with present reputed nitrification inhibitors, such as 2-urease inhibitor [43, 51], coated urea [52], nitrapyrin [53], dicyandiamide (DCD), and N-(n-butyl) thiophosphoric triamide (NBPT) [26], DCD and (3,4-dimethyl-1H-pyrazol-1-yl), succinic acid isomeric mixture (DMPSA) [29], fungal nitrification inhibitor not only effectively mitigated N2O emission from agricultural soil but little second pollution and energy-consumption different from chemical inhibitors as well. Meanwhile, fungal N2O inhibitors, such as Trichoderma asperellum, protected plants from disease due to their antagonism and stimulated crop growth when mixed with animal dung to produce bio-organic fertilizer to reduce environmental pollution of the production and application of the chemical fertilizer and pesticides, leading to cleaner husbandry production.

Although plant chemical secretion substances inhibit soil nitrification and N2O emissions, plants grow long and occupy much land to decrease the food supply and economic harvest, so farmers are reluctant to do so. It is difficult to practice. Relatively, fungal nitrification inhibitors such as Trichoderma asperellum in the present work can be fermented and produced in a shorter time to blend with animal dung to produce organic fertilizer, both providing plant nutrients, defending plant disease, stimulating plant growth, and reducing N2O emissions, instead of chemical fertilizer and pesticides, promoting agricultural carbon neutralization and decreasing environmental pollution. Trichoderma asperellum could be further investigated and developed into products that can be applied in agricultural carbon emission reduction and sustainable development.

Conclusions

The N2O-inhibiting fungus Z17 was identified as Trichoderma asperellum, capable of suppressing N2O emissions from soil with at least 106 CFU.g−1 soil. The best N2O-inhibiting effect was on day 9 of inoculation into soil because most of fungal numbers were present in soil.

Availability of data and materials

The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Mahanty S, Darpan R, Krishnan R. In vitro evaluation of the cytotoxic and bactericidal mechanism of the commonly used pesticide triphenyltin hydroxide. Chemosphere. 2017;183:339–352. https://doi.org/10.1016/j.chemosphere.2017.05.117.

    Article  PubMed  CAS  Google Scholar 

  2. Sharma M, Malyan SK, Saini N, Deepak B, Pugazhendhi A, Kumar SS. Towards sustainable agriculture with carbon sequestration, and greenhouse gas mitigation using algal biochar. Chemosphere. 2021;275: 129856. https://doi.org/10.1016/j.chemosphere.2021.129856.

    Article  CAS  Google Scholar 

  3. Eduardo A, Reyes-Palomo C, Díaz-Gaona C, Sanz-Cobena A, Smith P, García-Laureano R, Rodríguez-Estevez V. Greenhouse gas emissions from Mediterranean agriculture: evidence of unbalanced research efforts and knowledge gaps. Glob Environ Chang. 2021;69: 102391. https://doi.org/10.1016/j.gloenvcha.2021.

    Article  Google Scholar 

  4. Ravishankara AR, Daniel JS, Portmann RW. Nitrous oxide (N2O): the dominant ozone-depleting substance emitted in the 21st century. Science. 2009;326(5949):123–5. https://doi.org/10.1126/science.1176985.

    Article  PubMed  CAS  Google Scholar 

  5. Ciais P, Sabine C, Bala G, Bopp L, Brovkin V, Canadell J, Chhabra A, DeFries R, Galloway J, Heimann M. Carbon and other biogeochemical cycles. Climate change 2013 the physical science basis. In: Stocker TF, Qin D, Plattner GK, Tignor M, Allen SK, Boschung J, Nauels A, Xia Y, Bex V, Midgley PM, editors. Contribution of working group I to the fifth assessment report of the intergovernmental panel on climate change. Cambridge: Cambridge University Press; 2014. p. 465–570.

    Google Scholar 

  6. Scheer C, David EP, Klaus B-B. Editorial overview: climate change, reactive nitrogen, food security and sustainable agriculture-the case of N2O. Curr Opin Environ Sustain. 2020;47:A1–4. https://doi.org/10.1016/j.cosust.2020.11.001.

    Article  Google Scholar 

  7. IPCC. AR4 climate change 2007: Synthesis report. 2007. https://www.ipcc.ch/report/ar4/syr/.

  8. Lin W, Ding J, Xu C, Zheng Q, Zhuang S, Mao L, Li Q, Liu X, Li Y. Evaluation of N2O sources after fertilizers application in vegetable soil by dual isotopocule plots approach. Environ Res. 2020;188:109818. https://doi.org/10.1016/j.envres.2020.109818.

    Article  PubMed  CAS  Google Scholar 

  9. Tian H, Yang J, Lu C, Xu R, Canadell JG, Jackson R, et al. The global N2O model intercomparison project (NMIP): objectives, simulation protocol and expected products. Bull Am Meteorol Soc. 2018;99(6):1231–51. https://doi.org/10.1175/BAMS-D-17-0212.1.

    Article  Google Scholar 

  10. Thornton P, Gerald N, Dianne M, Mario H. Increases in extreme heat stress in domesticated livestock species during the twenty-first century. Glob Change Biol. 2021;00:1–11. https://doi.org/10.1111/gcb.15825.

    Article  CAS  Google Scholar 

  11. Chai LL, Hernandez-Ramirez G, Dyck M, Pauly D, Kryzanowski L, Middleton A, Powers L-A, Lohstraeter G, Werk D. Can fertigation reduce nitrous oxide emissions from wheat and canola fields? Sci Total Environ. 2020;745: 141014. https://doi.org/10.1016/j.scitotenv.2020.141014.

    Article  PubMed  CAS  Google Scholar 

  12. Smith P, Martino D, Cai Z, Gwary D, Janzen H, Kumar P. Policy and technological constraints to implementation of greenhouse gas mitigation options in agriculture. Agric Ecosyst Environ. 2007;118:6–28. https://doi.org/10.1016/j.agee.2006.06.006.

    Article  Google Scholar 

  13. Bouwman AF, van Grinsven JJM, Eickhout B. Consequences of the cultivation of energy crops for the global nitrogen cycle. Ecol Appl. 2010;20(1):101–9. https://doi.org/10.1890/08-0608.1.

    Article  PubMed  CAS  Google Scholar 

  14. Upadhyay RK, Patra DD, Tewari SK. Natural nitrification inhibitors for higher nitrogen use efficiency, crop yield, and for curtailing global warming. J Trop Agric. 2011;49:19–24.

    CAS  Google Scholar 

  15. Albanito F, Lebender U, Cornulier T, Sapkota TB, Brentrup F, Stirling C, Hillier J. Direct Nitrous oxide emissions from tropical and sub-tropical agricultural systems-a review and modelling of emission factors. Sci Rep. 2017;7:44235. https://doi.org/10.1038/srep44235.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Liyanage A, Peter RG, Clemens S, de Daniele R, Sudheera R, David WR. Carbon limits non-linear response of nitrous oxide (N2O) to increasing N inputs in a highly-weathered tropical soil in Sri Lanka. Agr Ecosyst Environ. 2020;292: 106808. https://doi.org/10.1016/j.agee.2019.106808.

    Article  CAS  Google Scholar 

  17. Wang L, Yang K, Gao C, Zhu L. Effect and mechanism of biochar on CO2 and N2O emissions under different nitrogen fertilization gradients from acidic soil. Sci Total Environ. 2020;747:141265. https://doi.org/10.1016/j.scitotenv.2020.141265.

    Article  PubMed  CAS  Google Scholar 

  18. Ameloot N, Peter M, De Stefaan N, Steven S. Biochar-induced N2O emission reductions after field incorporation in a loam soil. Geoderma. 2016;267:10–6. https://doi.org/10.1038/srep39574.

    Article  CAS  Google Scholar 

  19. Yajun GE, Yiming YU, Yingcheng MI, Junzhang ZH, Huang M, Zhang Y, Hong WA, Qirong SH, Jianwen ZO, Shuqing LI. Decreased nitrous oxide emissions associated with functional microbial genes under bio-organic fertilizer application in vegetable fields. Pedosphere. 2021;31(2):279–88. https://doi.org/10.1016/S1002-0160(20)60075-3.

    Article  CAS  Google Scholar 

  20. Grutzmacher P, Puga AP, Bibar MP, Coscione AR, Packer AP, de Andrade CA. Carbon stability and mitigation of fertilizer induced N2O emissions in soil amended with biochar. Sci Total Environ. 2018;625:1459–66. https://doi.org/10.1016/j.scitotenv.2017.12.196.

    Article  PubMed  CAS  Google Scholar 

  21. Yuan H, Zeng J, Yuan D, Zhang L, Qin S, Wrage-Mönnig N, Clough T, Zhou S. Co-application of biochar and an electric potential accelerates soil nitrate removal while decreasing N2O emission. Soil Biol Biochem. 2020;149:107946. https://doi.org/10.1016/j.soilbio.2020.107946.

    Article  CAS  Google Scholar 

  22. Nishizawa T, Aihua Q, Ayaaki K, Kanako T, Satoshi I, Shen Ws, Kazuo I, Shigeto O, Keishi S. Inoculation with N2-generating denitrifier strains mitigates N2O emission from agricultural soil fertilized with poultry manure. Biol Fertil Soils. 2014;50:1001–7. https://doi.org/10.1007/s00374-014-0918-7.

    Article  Google Scholar 

  23. Lata JC, Guillaume K, Degrange V, Abbadie L, Lensi R. Relationships between root density of the African grass Hyparrhenia diplandra and nitrification at the decimetric scale, an inhibition-stimulation balance hypothesis. Proc Biol Sci. 2000;267(1443):595–600. https://doi.org/10.1098/rspb.2000.1043.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  24. Daniel JA, Luis AS, Norman GH. Molecular biology and biochemistry of ammonia oxidation by Nitrosomonas europaea. Archae Microbiol. 2002;178(4):250–5. https://doi.org/10.1007/s00203-002-0452-0.

    Article  CAS  Google Scholar 

  25. Laffite A, Florio A, Andrianarisoa KS, Charline Des Chatelliers C, Schloter-Hai B, Ndaw SM, Periot C, Schloter M, Zeller B, Poly F, Le Roux X. Biological inhibition of soil nitrification by forest tree species affects Nitrobacter populations. Environ Microbiol. 2002;22(3):1141–53. https://doi.org/10.1111/1462-2920.14905.

    Article  CAS  Google Scholar 

  26. Hube S, Marta AA, Clemens S, Christian B, Luis R, David R, Peter G. Effect of nitrification and urease inhibitors on nitrous oxide and methane emissions from an oat crop in a volcanic ash soil. Agr Ecosyst Environ. 2017;238:46–54. https://doi.org/10.1016/j.agee.2016.06.040.

    Article  CAS  Google Scholar 

  27. Chen H, Zhou J, Li B, Xiong Z. Yield-scaled N2O emissions as affected by nitrification inhibitor and overdose fertilization under an intensively managed vegetable field: a three-year field study. Atmos Environ. 2019;206:247–57. https://doi.org/10.1016/j.atmosenv.2019.02.036.

    Article  CAS  Google Scholar 

  28. Cui P, Fan F, Yin C, Li Z, Song A, Wan Y, Liang Y. Urea- and nitrapyrin-affected N2O emission is coupled mainly with ammonia oxidizing bacteria growth in microcosms of three typical Chinese arable soils. Soil Biol Biochem. 2013;66:214–21. https://doi.org/10.1016/j.soilbio.2013.08.001.

    Article  CAS  Google Scholar 

  29. Guardia G, Max TC, Gemma A, Alberto S-C, Sonia G-M, José MÁ, Jaime R-H, Antonio V. Effect of inhibitors and fertigation strategies on GHG emissions, NO fluxes and yield in irrigated maize. Field Crops Res. 2017;204:135–45. https://doi.org/10.1016/j.fcr.2017.01.009.

    Article  Google Scholar 

  30. Zidian He, Shiqing S, Yufeng G, Yanxia S, Baoju Li. Detection of Trichoderma asperellum colonization in soils by real-time fluorescent quantitative PCR. J Plant Prot. 2016;43(4):552–8. https://doi.org/10.13802/j.cnki.zwbhxb.2016.04.004.

    Article  CAS  Google Scholar 

  31. Wu H-S, Li J, Chen S-Y, Liu D-Y, Kendall J, Xu Y, et al. A newly practice to mitigate N2O emission from winter wheat soil by intercropping Isatis indigotica. J Agric Sci. 2016;8(7):7–22.

    Google Scholar 

  32. Subbarao GV, Rondon M, Ito O, Ishikawa T, Rao IM, Nakahara K, Lascano C, Berry WL. Biological nitrification inhibition (BNI)-is it a widespread phenomenon? Plant Soil. 2007;294:5–18. https://doi.org/10.1007/s11104-006-9159-3.

    Article  CAS  Google Scholar 

  33. Fillery IRP. Plant-based manipulation of nitrification in soil: a new approach to managing N loss? Plant Soil. 2007;294:1–4. https://doi.org/10.1007/s11104-007-9263-z.

    Article  CAS  Google Scholar 

  34. Wu Z, Zhang Q, Zhang X, Duan P, Yan X, Xiong Z. Biochar-enriched soil mitigated N2O and NO emissions similarly to fresh biochar for wheat production. Sci Total Environ. 2020;701:134943. https://doi.org/10.1016/j.scitotenv.2019.134943.

    Article  PubMed  CAS  Google Scholar 

  35. de Klein CAM, Ledgard SF. Nitrous oxide emissions from New Zealand agriculture—key sources and mitigation strategies. Nutr Cycle Agroecosyst. 2005;72:77–85. https://doi.org/10.1007/s10705-004-7357-z.

    Article  CAS  Google Scholar 

  36. Rossiter-Rachor NA, Setterfield SA, Douglas MM, Hutley LB, Cook GD, Schmidt S. Invasive Andropogon gayanus (gamba grass) is an ecosystem transformer of nitrogen relations in Australian savanna. Ecol Appl. 2009;19(6):1546–60. https://doi.org/10.1890/08-0265.1.

    Article  PubMed  CAS  Google Scholar 

  37. Subbarao GV, Tomohiro B, Masahiro K, Osamu I, Samejima H, Wang HY, Pearse SJ, Gopalakrishnan S, Nakahara K, Zakir Hossain AK, Tsujimoto H, Berry WL. Can biological nitrification inhibition (BNI) genes from perennial Leymus racemosus (Triticeae) combat nitrification in wheat farming? Plant Soil. 2007;299(1–2):55–64. https://doi.org/10.1007/s11104-007-9360-z.

    Article  CAS  Google Scholar 

  38. Nogueira CB, Menéndez E, Ramírez-Bahena MH, Velázquez E, Peix Á, Mateos PF, Scotti MR. The N-fixing legume Periandra mediterranea constrains the invasion of an exotic grass (Melinis minutiflora P. Beauv) by altering soil N cycling. Sci Rep. 2019;9(1):11033. https://doi.org/10.1038/s41598-019-47380-5.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  39. Elrys AS, Desoky ES, El-Maati MF, Elnahal AS, Abdo AI, Raza S, Zhou J. Can secondary metabolites extracted from Moringa seeds suppress ammonia oxidizers to increase nitrogen use efficiency and reduce nitrate contamination in potato tubers? Ecotoxicol Environ Saf. 2019;185:109689. https://doi.org/10.1016/j.ecoenv.2019.109689.

    Article  PubMed  CAS  Google Scholar 

  40. Sahrawat KL. Comparison of karanjin with other nitrification inhibitors for retardation of nitrification of urea N in soil. Plant Soil. 1981;59(3):495–8. https://doi.org/10.1007/BF02184555.

    Article  CAS  Google Scholar 

  41. Patra DD, Anwar M, Chand S. Use of mint essential oil as an agrichemical, control of N-loss in crop fields by using mint essential oil coated urea as fertilizer. Curr Sci. 2001;81(12):1526–8.

    Google Scholar 

  42. Patra DD, Anwar M, Chand S, Kiran U, Rajput DK, Kumar S. Nimin and Mentha spicata oil as nitrification inhibitors for optimum yield of Japanese mint. Commun Soil Sci Plant Nutr. 2002;33(3–4):451–60. https://doi.org/10.1081/CSS-120002756.

    Article  CAS  Google Scholar 

  43. Patra DD, Kiran U, Pande P. Urease and nitrification retardation properties in natural essential oils and their by-products. Commun Soil Sci Plant Nutr. 2007;37(11–12):45–53. https://doi.org/10.1080/00103620600710306.

    Article  CAS  Google Scholar 

  44. Kumar R, Devakumar C, Sharma V, Kakkar G, Kumar D, Pachauri RK, Allen MR, Barros VR, Broome J, Cramer W, Christ R, Church JA, Clarke L, Dahe Q, Dasgupta P. Climate change 2014 synthesis report. Contribution of working groups I, II and III to the fifth assessment report of the Intergovernmental panel on climate change. Geneva: IPCC; 2014.

    Google Scholar 

  45. Castaldi S, Carfora A, Fiorentino A, Natale A, Messere A, Miglietta F. Cotrufo MF Inhibition of net nitrification activity in a Mediterranean woodland: possible role of chemicals produced by Arbutus unedo. Plant Soil. 2009. https://doi.org/10.1007/s11104-008-9750-x.

    Article  Google Scholar 

  46. de Sousa TP, Chaibub AA, da Silva GB, de Filippi MC. Trichoderma asperellum modulates defense genes and potentiates gas exchanges in upland rice plants. Physiol Mol Plant Pathol. 2020;112:101561. https://doi.org/10.1016/j.pmpp.2020.101561.

    Article  CAS  Google Scholar 

  47. Macías-Rodríguez L, Contreras-Cornejo HA, Adame-Garnica SG, Del-Val E, Larsen J. The interactions of Trichoderma at multiple trophic levels: inter-kingdom communication. Microbiol Res. 2020;240: 126552. https://doi.org/10.1016/j.micres.2020.126552.

    Article  PubMed  CAS  Google Scholar 

  48. Khan MY, Haque MM, Molla AH, Rahman MM, Alam MZ. Antioxidant compounds and minerals in tomatoes by Trichoderma-enriched bio-fertilizer and their relationship with the soil environments. J Integr Agric. 2017;16(3):691–703. https://doi.org/10.1016/S2095-3119(16)61350-3.

    Article  CAS  Google Scholar 

  49. Sanz-Cobena A, Ding W, Mueller C, Zaman M, Heng L. Mitigating greenhouse gas emissions from croplands and pasturelands-climate-smart agriculture. Pedosphere. 2021;31(2):227–30. https://doi.org/10.1016/S1002-0160(20)60065-0.

    Article  Google Scholar 

  50. Moreira FM, Cairo PA, Borges AL, da Silva LD, Haddad F. Bacillus sp. and Trichoderma asperellum inoculations for optimal growth and nutrient content of banana seedlings. S Afr J Bot. 2021;137:249–56. https://doi.org/10.1016/j.sajb.2020.10.021.

    Article  CAS  Google Scholar 

  51. Bremner JM. Recent research on problems in the use of urea as a nitrogen fertilizer. Fertil Res. 1995;42:321–9. https://doi.org/10.1007/BF00750524.

    Article  CAS  Google Scholar 

  52. Patra DD, Kiran U, Chand S, Anwar M. Use of urea coated with natural products to inhibit urea hydrolysis and nitrification in soil. Biol Fertil Soils. 2009;45:617–21. https://doi.org/10.1007/s00374-009-0372-0.

    Article  Google Scholar 

  53. Tian D, Zhang Y, Zhou Y, Mu Y, Liu J, Zhang C, Liu P. Effect of nitrification inhibitors on mitigating N2O and NO emissions from an agricultural field under drip fertigation in the North China Plain. Sci Total Environ. 2017;598:87–96. https://doi.org/10.1016/j.scitotenv.2017.03.220.

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

The authors would like to thank the students of the Nanjing University of Information Science and Technology Ya Xu, Xiao-xia Shang who partially joined this work. We are grateful to Springer Nature Research Square for their editing and polishing for this submission.

Funding

Authors are grateful for the financial support of  the National Major Special Plan for Water Pollution Control and Treatment Science and Technology of China (2015ZX07204-002).

Author information

Authors and Affiliations

  1. Department of Agricultural Resources and Environment, College of Applied Meteorology, Nanjing University of Information Science and Technology, Nanjing, 210044, China

    Hong-sheng Wu, Su-yun Chen, Ti-jian Wang, Li-dong Shen, Yan-hui Li, Zheng Liu & Ji Li

  2. Nanjing Institute of Environmental Sciences, Ministry of Ecology and Environment of China, Nanjing, 210080, China

    Jun Ding & Wei Tian

  3. College of Atmosphere Science, Nanjing University, Nanjing, 210080, China

    Wei Tian

Authors
  1. Hong-sheng Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Su-yun Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Jun Ding
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Wei Tian
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Ti-jian Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Li-dong Shen
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Yan-hui Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Zheng Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Ji Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

HSW: experimental design, writing and instruction, supervision; SYC: conducting experiment, determination and data process and analysis; JD: assisted data analysis; LDS: data analysis; WT: experimental design; TJW: data process and graphics; YHL: preview of manuscript and corrections; ZL: preview of manuscript and corrections; JL: part of experimental work. All the authors read and approved the final manuscript.

Corresponding authors

Correspondence to Hong-sheng Wu or Wei Tian.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wu, Hs., Chen, Sy., Ding, J. et al. New finding of Trichoderma asperellum in decreasing soil N2O emission. Chem. Biol. Technol. Agric. 9, 77 (2022). https://doi.org/10.1186/s40538-022-00338-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40538-022-00338-8

Keywords