Skip to main content
Chemical and Biological Technologies in Agriculture
Download PDF
Download ePub

Characteristic analysis of BpbZIP family genes and BpbZIP26 significantly enhanced triterpenoid production in Betula platyphylla under S-nitrosothiol treatment

Chemical and Biological Technologies in Agriculture volume 9, Article number: 97 (2022) Cite this article

Abstract

Background

Basic leucine zipper (bZIP) transcription factors are crucial in plant development, and response to environmental stress, etc. With the development of sequencing technology and bioinformatics analysis, the bZIP family genes has been screened and identified in many plant species, but bZIP family genes has not been systematically characterized and identified their function in Betula platyphylla.

Methods

B. platyphylla reference genome was used to characterize bZIP family genes. The physicochemical properties, chromosome distribution, gene structure, and syntenic relationships were analyzed by bioinformatics methods. The effect of BpbZIP26 on triterpenoid production was investigated using Agrobacterium-mediated transient transformation under N6022 treatment.

Results

51 bZIP family genes were identified in B. platyphylla, and named BpbZIP1–BpbZIP51 sequentially according to their positions on chromosomes. All BpbZIP genes were unevenly distributed on 14 chromosomes, and divided into 13 subgroups according to the classification of Arabidopsis thaliana bZIP proteins. 12 duplication events were detected in the B. platyphylla genome, and 28 orthologs existed between B. platyphylla and A. thaliana, 83 orthologs existed between B. platyphylla and Glycine max, and 73 orthologs existed between B. platyphylla and Populus trichocarpa. N6022 treatment changed gene expression levels of most BpbZIPs in seedlings of B. platyphylla. Among of them, N6022 treatment significantly enhanced gene expression levels of BpbZIP26 in leaves, stems and roots of B. platyphylla. BpbZIP26 mediated triterpenoid production, and N6022 treatment further enhanced triterpenoid production in BpbZIP26 overexpression calli of B. platyphylla using Agrobacterium-mediated transient transformation.

Conclusion

This work highlights potential BpbZIP family genes responding to S-nitrosothiol and provides candidate genes for triterpenoid production in B. platyphylla.

Graphical Abstract

Introduction

Basic leucine zipper (bZIP) is one of the largest transcription factors (TFs) families in plants, its proteins contain a highly conserved 60–80 amino acid sequence that includes a basic region (N-×7-R/K sequence) and a leucine zipper [1, 2]. Increasing number of bZIP have recently been identified in multiple plant species based on the whole genome or full-length transcriptome sequences, and its family size are different, such as 78 in A. thaliana [1], 47 in Betula pendula Roth [3], 125 in Zea mays [4]. Based on conserved domains and sequence similarities of their basic regions, bZIP TFs can be divided into 11–14 subgroups that have different functions [1, 3,4,5,6]. For example, bZIP family of A. thaliana was divided into 13 groups, most of Group A bZIPs involved in ABA signaling, Group F bZIPs regulated Zn transporters, Group H and G subfamilies regulated photoresponse [1]. Growing studies suggest that bZIP TFs are crucial in plant growth, development, regulation of secondary metabolite synthesis, and response to environmental stress [7, 8]. However, there is still a large proportion of bZIP TFs has not been identified their function in plants.

Nitric oxide (NO) is a signaling molecule distributing throughout all living organisms, and it is involved in multiple plant processes, including growth, development, and biotic and abiotic stress responses [9, 10]. The accumulating data indicate that NO is executed through S-nitrosylation, which is the addition of an NO moiety to a protein cysteine thiol to form an S-nitrosothiol (SNO) [10]. Similar to other posttranslational modifications, S-nitrosylation regulates protein activities, including stability, biochemical activity, subcellular localization, and protein–protein interaction. The difference is that S-nitrosylation can be reversed by S-nitrosoglutathione reductase (GSNOR), it degrades S-nitrosoglutathione (the major cellular NO donor) to oxidized glutathione (GSSG) and ammonia. Plants with null or reduced expression of GSNOR show increased levels of total SNO, and conversely, that GSNOR overexpressing plants show reduced SNO content [10, 11]. Therefore, the level of S-nitrosated proteins corresponds to SNO levels.

Our precious study verified that SNO enhanced betulin production using BpGSNOR transgenic B. platyphylla seedlings by RNAi silencing and GSNOR inhibitor N6022, and it indicated that protein S-nitrosylation mediated betulin production in B. platyphylla, which is a pioneer hardwood tree species with rich medical triterpenoid [12, 13]. Some bZIP TFs can promote secondary metabolite synthesis, such as VvbZIP36, PybZIP, and PgbZIP promotes anthocyanin accumulation in grapevine, Pear, and pomegranate, respectively [11, 14, 15]. Given the importance of bZIP TFs in secondary metabolite biosynthesis in plants, the functional characterization of bZIP TFs family members in betulin biosynthesis of B. platyphylla has not been systematically investigated, especially under SNO treatment. Therefore, in this study, the latest B. platyphylla reference genome was used to characterize bZIP TFs [16], a bZIP gene predicted to be involved in triterpenoid synthesis, was cloned and verified via transient transformation in B. platyphylla under SNO treatment. The results of this study will contribute to the functional characterization of bZIP TFs in B. platyphylla.

Materials and methods

Identification of BpbZIP genes

All annotated sequences were obtained from the genome of B. platyphylla (accession code PRJNA285437) [16], and bZIP domain (PF00170) downloaded from the Pfam database was used to detect the possible bZIP protein of B. platyphylla through the HMM search program (E value < 1 × 10−5). All putative proteins were subjected to conserved structural domain identification using SMART software and the NCBI–CDD database [17]. Fifty-one BpbZIP family genes were identified and numbered according to their positions on chromosomes.

Analysis of physiochemical properties, localization, and gene structures

The physicochemical properties, protein molecular weights (MW), and theoretical isoelectric points (pI) of the 51 identified bZIP proteins were analyzed by ExPASy-ProtParam. The subcellular localization was predicted by Plant-mPLoc [17]. The chromosome location information was analyzed using TBtools software. The conserved motifs of the 51 BpbZIP proteins were analyzed by Multiple expectation maximization for motif elicitation (MEME), and the maximum number of motifs was set to 10 (width range of motif = 6–300 residues). PHYLOGENY in MEGA X software was adopted to construct a maximum-parsimony tree through 1000 bootstrap replications. The above precited results were visualized using TBtools software [17, 18].

Construction of the phylogenetic trees

Clustal W in MEGA X software were used to align the amino acid sequences of the 51 BpbZIP proteins and 78 A. thaliana bZIP proteins, and PHYLOGENY in MEGA X software was used to draw a neighbor-joining tree (1000 bootstrap replications) [4, 17]. The phylogenetic tree was modified using the online software EvolView.

Cis-acting element predictions and evolution analysis

The 2000 bp upstream sequence of each B. platyphylla bZIP was extracted and submitted to PlantCARE for cis-regulating elements functions prediction analysis. The duplication events in BpbZIPs, and syntenic relationships among B. platyphylla, A. thaliana, G. max, and P. trichocarpa were analyzed using TBtools software [17, 18]. The above precited results were visualized using TBtools software.

Plant materials and N6022 treatment

Thirty-day-old seedlings of B. platyphylla obtained from sterile seeds were treated with 60 μmol L−1 3-(5-(4-(1H-imidazol-1-yl) phenyl)-1-(4-carbamoyl-2-methylphenyl)-1H-pyrrol-2-yl) propionic acid (N6022, a GSNOR inhibitor) for 24 h, and 15-day-old calli of B. platyphylla obtained from tissue-cultured seedlings were used for Agrobacterium-mediated transient transformation and N6022treatment. The controls were treated with the same volume of distilled water. N6022 was purchased from Sigma Corporation (St Louis, MO, USA). The seedlings were planted in a woody plant medium supplemented with 20 g L−1 of sucrose. The calli were cultured in B5 medium supplemented with 0.3 mg L−1 of 6-benzyladenine, 0.6 mg L−1 of thidiazuron, and 20 g L−1 of sucrose. The pH of the medium was adjusted to 5.6 ± 0.2 prior to autoclaving [19]. Fresh samples frozen with liquid nitrogen were used for gene expression, and samples dried through the oven-drying method were used for the analysis of triterpenoid content [19].

Cloning of full-length BpbZIP26

The full-length sequence of BpbZIP26 was amplified by the following PCR primers: F: ATATTGTCAACACATTGCCTG, R: AAACAAAATGATCTTACGCTT. PCR amplification was set as follows: 94 °C for 5 min; 35 cycles of 98 °C for 10 s, 50 °C for 45 s, and 72 ° C for 1 min; and 72 °C for 10 min. Positive colonies (purified PCR amplification fragment ligated with pMDTM18-T vector) were sequenced at Rui Biotech (Beijing) [17].

Agrobacterium-mediated transient transformation

Agrobacterium tumefaciens strain LBA4404 harboring pBWA(V)HS-BpbZIP26-GLosgfp (overexpression vector) or pBWA(V)KS-BpbZIP26-GUS (RNAi vector) was used to infect 15-day-old B. platyphylla calli (soaked in 25% sucrose for 5 min) for 1 h. The infection solution was reported by Liu et al. [16], and the main reagent as follows: 2 mM L−1 of MES–KOH (pH 5.4), 10 mmol L−1 of CaCl2, 120 μmol L−1 of acetosyringone (AS), 2% sucrose, 270 mmol L−1 of mannitol, and 200 mg L−1 of dithiothreitol + 0.02% Tween. The infected calli (15 g calli per replicate) were cultured in B5 liquid medium containing 100 μmol L−1 of AS for 2 days in the dark at 28 °C [17]. Then, the infected calli were washed with distilled water for analysis of gene expression and total triterpenoid content.

Determination of the total triterpenoid content

Fried samples (0.05 g) were accurately weighed and soaked in 5 mL of 95% ethanol for 24 h. The samples were extracted at 70 °C for 1 h in a water bath, and then ultrasound-assisted extraction (10 kHz) for 40 min. After centrifugation at 4000 rmp for 10 min, 1 mL of the supernatant solution was obtained for content analysis [19]. The total triterpenoid content was determined using the vanillin–glacial acetic acid colorimetric method with betulin as the standard, and the linear equation was y = 0.03483x + 0.0002 (R2 = 0.9995), where x indicates the absorbance of the solution at 551 nm.

Gene expression analysis

The total RNA was isolated using a CTAB-based method, and 1 µg RNA of each sample was reversed into cDNA according to instructions of the PrimeScriptTM RT reagent Kit (TaKaRa, Japan). The Taqman probes and primers are presented in Additional file 1: Tables 1, 2. PCR amplification was performed on a Roche LightCycler 480 real-time PCR system as follows: 95 °C for 15 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Each RT-qPCR analysis was performed with three technical replicates. Gene expression data were calculated with the 2−ΔΔCt method [20].

Statistical analysis

The data presented in the figures were the mean ± standard deviation of three biological replicates, and analyzed through one-way ANOVA using SPSS version 21.0. The different letters show significant differences among means (P < 0.05, Tukey’s test) [17].

Results

Genome-wide identification of BpbZIPs

Fifty-one genes with conserved bZIP domains were identified in the B. platyphylla genome and named BpbZIP1–BpbZIP51 sequentially according to their positions on chromosomes. All BpbZIP genes were unevenly distributed on 14 chromosomes, with chromosome 1 containing the most genes (7 BpbZIP genes) and chromosomes 7 containing a single BpbZIP gene, and most of BpbZIPs were distributed at both ends of the chromosomes (Fig. 1).

Fig. 1
figure 1

Chromosomal locations of BpbZIPs in B. platyphylla. The chromosomal position of 51 BpbZIP family genes were mapped according to the B. platyphylla genome (PRJNA285437) using TBtools software. The left scale indicated the length of the chromosome

Full size image

The physicochemical properties of 51 BpbZIP proteins showed that the number of amino acids ranged from138 (BpbZIP25 and BpbZIP30) to 584 (BpbZIP17), molecular weight ranged from 15.71 (BpbZIP25 and BpbZIP30) to 63.67 (BpbZIP17) kD, and isoelectric points ranged from 4.50 (BpbZIP22) to 10.16 (BpbZIP7) (Table 1). The subcellular location predicted that most of the proteins were nuclear proteins. Only BpbZIP2, BpbZIP7, BpbZIP22, BpbZIP29, BpbZIP40, and BpbZIP48 were distributed in the chloroplast.

Table 1 Sequence information of BpbZIP gene family
Full size table

Phylogenetic analysis of BpbZIPs

In accordance with the classification of A. thaliana bZIP proteins, 51 BpbZIP proteins were divided into 13 subgroups except for BpbZIP33 and BpbZIP38, which were named as Subgroups A, B, C, D, E, F, G, H, I, J, K, M, and S (Fig. 2). The largest subgroup S contained 11 BpbZIP members, followed by the Groups A and I containing 8 and 6 BpbZIP members, respectively. Subgroup J, K, and M all had only one protein. This suggested the members of bZIP proteins involved in plant starvation signalling, abscisic acid or stress signalling and vascular development, etc. [1].

Fig. 2
figure 2

Phylogenetic tree of B. platyphylla and A. thaliana. The outermost letters A to S indicated that 51 BpbZIP proteins were divided into 13 subgroups except for BpbZIP33 and BpbZIP38 according to the classification of A. thaliana bZIP proteins, white dots were AtbZIP proteins, and red star were BpbZIP proteins

Full size image

Evolutionary analysis of BpbZIPs

As shown in Fig. 3a, 12 duplication events with 51 BpbZIP genes were detected in the B. platyphylla genome. One pair of genes (BpbZIP40 and BpbZIP41) was found to have undergone a tandem duplication event and five pairs of genes (BpbZIP4 and BpbZIP36, BpbZIP4 and BpbZIP20, BpbZIP6 and BpbZIP20, BpbZIP8 and BpbZIP22, BpbZIP11 and BpbZIP27) underwent a fragment duplication event. This evidence suggested that fragment duplication events were a major driver of BpbZIP gene diversity. The syntenic relationships of the BpbZIP genes showed that 28 orthologs existed between B. platyphylla and A. thaliana (Fig. 3b), 83 orthologs existed between B. platyphylla and G. max (Fig. 3c), and 73 orthologs existed between B. platyphylla and P. trichocarpa (Fig. 3d). The differences in numbers of orthologous pairs were related to the evolutionary distance [21].

Fig. 3
figure 3

Evolutionary analysis of BpbZIPs. (a) 12 duplication events were detected in the B. platyphylla genome. (b) Synteny analysis of BpbZIP genes between B. platyphylla and A. thaliana. (c) Synteny analysis of BpbZIP genes between B. platyphylla and G. max. (d) Synteny analysis of BpbZIP genes between B. platyphylla and P. trichocarpa

Full size image

Conserved motifs and gene structures

A total of 20 conserved amino acid motifs were identified in the BpbZIP proteins (Fig. 4b), and motifs with similar structures and domains were clustered into one group indicating that they had an analogous function (Fig. 4a), such as group I (BpbZIP13, BpbZIP28, BpbZIP40, BpbZIP41, BpbZIP5, and BpbZIP9). Motif1 was distributed in all members of the BpbZIPs, which was recognized as bZIP conserved domain sequence. However, some motifs were very rare, such as motif 19 only found in group I, motif 18 in group F.

Fig. 4
figure 4

Gene structures of the BpbZIP genes. (a) The phylogenetic tree of 51 BpbZIP proteins. (b) 20 motifs in the BpbZIPs were represented by different colored boxes. (c) Exon/intron structures of BpbZIP genes. Yellow boxes, blue boxes, and gray line indicated exons, untranslated regions (UTR), and introns at each BpbZIP gene, respectively

Full size image

Gene structure is one of the important parameters for gene family evolution that further supports phylogenetic trees. Gene structure analysis was performed on the 51 BpbZIP genes (Fig. 4c). The results showed that 78.43% (40/51) of the BpbZIPs had introns varying from 1 (BpbZIP29) to 13 (BpbZIP2, 46), and the eleven intron-less genes were BpbZIP3, 4, 11, 14, 17, 20, 24, 27, 30, 36, and 47. In addition, 70.59% (36/51) of the BpbZIPs had untranslated regions (UTRs) varying from 1 (BpbZIP1, 5, 6, 15, 25, 31, 35, 40, 43, 48) to 3 (BpbZIP22, 46), and the 15 genes (BpbZIP3, 4, 11, 14, 17, 20, 24, 27, 29, 30, 33, 36, 37, 38, 47) had no UTR.

The cis-elements in the promoter regions of BpbZIPs

The 2.0 kb promoter region located upstream of the transcriptional start site of each BpbZIP gene was used to predict their possible expression regulation patterns (Fig. 5). The cis-elements of the BpbZIPs belonging to the same group in phylogenetic analysis did not show the same pattern. The number of responsive elements ranged from 25 (BpbZIP26) to 84 (BpbZIP1), and light, hormone, and stress were three main categories of responsive elements. Light responsive elements were the most prevalent in all the BpbZIPs promoters varying from 4(BpbZIP36, 47) to 34(BpbZIP1), and Gbox and box4 were the top two responsive elements. ABA and JA were the dominant hormone elements. Wound-responsive element was rich in the stress responsive elements. The different types and amounts of cis-elements in the promoters of BpbZIPs suggested that they might had different functions in B. platyphylla growth and development.

Fig. 5
figure 5

Cis-elements in the promoter regions of BpbZIPs. The 2.0 kb promoter region located upstream of each BpbZIP gene was used to predict by PlantCARE. The number of different kinds of cis-elements were represented with the colored circle

Full size image

Gene expression of BpbZIPs under S-nitrosation treatment

qRT-PCR was used to investigate gene expression patterns of BpbZIPs in response N6022 treatment. The results revealed that all BpbZIP genes expressed in control tissues of B. platyphylla, and 62.7% BpbZIPs (32 genes) in leaves were higher than that of stems and roots (Fig. 6). Among them, BpbZIP21, BpbZIP17 and BpbZIP26 highly expressed in leaves, BpbZIP16, BpbZIP26 and BpbZIP21 in stems, BpbZIP16, BpbZIP24 and BpbZIP15 in roots. N6022 treatment changed gene expression levels of BpbZIPs in B. platyphylla seedlings, BpbZIP16, BpbZIP2 and BpbZIP26 highly expressed in leaves, and their increases were 3.96, 2.36, and 2.06 times greater than those of controls, respectively. BpbZIP 25 and BpbZIP26 highly expressed in stems under N6022 treatment, and their increases were 19.53 and 1.70 folds higher than those of controls, respectively. BpbZIP35, BpbZIP33, and BpbZIP26 highly expressed in roots under N6022 treatment, their increases were 27.4, 15.8, and 12.50 folds greater than those of controls, respectively. The above results suggested that BpbZIP26 may play a key role in B. platyphylla responses to S-nitrosation treatment. Hence, we cloned BpbZIP26 via PCR (Additional file 1: Figs. 1, 2).

Fig. 6
figure 6

Gene expression levels of BpbZIPs in seedlings of B. platyphylla under N6022 treatment. Thirty-day-old seedlings of B. platyphylla obtained from sterile seeds were treated with 60 μmol L−1 3-(5-(4-(1H-imidazol-1-yl) phenyl)-1-(4-carbamoyl-2-methylphenyl)-1H-pyrrol-2-yl) propionic acid (N6022, a GSNOR inhibitor) for 24 h

Full size image

Overexpression of BpbZIP26 enhanced triterpenoid production under S-nitrosation treatment

Our previous study showed that N6022 treatment significantly enhanced triterpenoid content [11, 12], and it also significantly increased gene expression of BpbZIP26. To investigate the function of BpbZIP26 in triterpenoid synthesis, overexpression and silencing vector of BpbZIP26 were constructed to transfer into B. platyphylla calli. After 3 days of Agrobacterium-mediated transient transformation, the silencing of BpbZIP26 in B. platyphylla calli (0.44 times than that of untransformed calli) significantly decreased the triterpenoid contents (40.46%) and reduced the gene expression of BpCAS, BpLUS, and BpβAS, which are key enzyme genes for triterpenoid synthesis. The overexpression of BpbZIP26 in B. platyphylla calli (812 times than that of untransformed calli) enhanced the triterpenoid contents (26.21%) and increased the gene expression of BpCAS, BpLUS, and BpβAS. N6022 treatment further enhanced triterpenoid contents (90.38% and 65.44%) and gene expression of BpCAS, BpLUS, and BpβAS in control and overexpression of BpbZIP26 calli of B. platyphylla (Fig. 7). The above results suggested that BpbZIP26 mediated triterpenoid production under control and S-nitrosation treatment.

Fig. 7
figure 7

BpbZIP 26 regulated triterpenoid production using Agrobacterium-mediated transient transformation. Fifteen-day-old calli of B. platyphylla were used for Agrobacterium-mediated transient transformation and 60 μmol L−1 N6022 treatment

Full size image

Discussion

In our study, 51 BpbZIPs were identified in the B. platyphylla genomes for the first time, and its family size was larger than that the same genus of B. pendula (47) [3]. Further analysis showed that the genome size of B. platyphylla (441 Mb) and B. pendula (440 Mb) was the about the same size, but bZIPs of B. pendula and B. platyphylla were divided into 10 and 13 groups according to the clustering with A. thaliana, respectively. In addition, they all had 1–2 genes that are not clustered with A. thaliana. It can be seen that there are differences in bZIP gene family size and clustering among Betula species, different clustering suggested that they could have different function, those will be verified experimentally in the future.

Genomic chromosome localization analysis showed that bZIPs of Lycopersicon esculentum (69 SlbZIPs) and G. max (160 GmbZIPs) were unevenly distributed in all chromosomes, but bZIPs in Vitis vinifera (55 VvbZIPs), Citrullus lanatus (62ClabZIP), and Nicotiana tabacum (77 NtbZIPs) were concentrated in some chromosomes. In addition, 6 bZIPs in Raphanus sativus (135 RsbZIPs) and 9 genes in Pyrus breschneideri (92 PbrbZIPs) had unassigned scaffolds in chromosomes [22,23,24,25,26,27,28]. In our study, 51 BpbZIPs were unevenly distributed in all the chromosomes of B. platyphylla. The above results revealed that the number of bZIP gene family was irrelevant to the chromosome size. Evolutionary analysis of BpbZIPs showed that 28 orthologs existed between B. platyphylla and A. thaliana, 83 orthologs existed between B. platyphylla and G. max, and 73 orthologs existed between B. platyphylla and P. trichocarpa. It seems that the evolution events in bZIP gene family members have happened before the divergence of species, which affected their gene family numbers and evolutionary distance.

The cis-elements in the promoter regions of bZIPs and increasing experimental data indicated that the bZIP genes played important roles in plant growth and response to multiple stresses [1, 2]. NO is a ubiquitous gasotransmitter produced in living cells under normal as well as under conditions of biotic and abiotic stress. The major bioactivity of NO is executed via S-nitrosylation by covalently adding an NO group onto the reactive cysteine thiol of a protein to form SNO, which is regulated by GSNOR [10, 11]. It can be seen that both bZIPs and NO are all involved in plant growth and stress response. Therefore, how bZIPs responds to SNO has not yet been reported.

To investigate the effect of SNO on gene expression of 51 BpbZIPs, 30-day-old seedlings of B. platyphylla obtained from sterile seeds were treated with 60 μmol L−1 N6022 (a GSNOR inhibitor) for 24 h. The results revealed that gene expression levels of 62.7% BpbZIPs (32 genes) in leaves were higher than that of stems and roots in B. platyphylla, and N6022 treatment changed expression levels of most BpbZIP genes. Among of them, N6022 treatment significantly increased gene expression of BpbZIP26 in leaves, stems, and roots of B. platyphylla. The above results suggested that the BpbZIP genes can respond to SNO, and BpbZIP26 may play a key role in responses to SNO.

Some bZIP TFs can regulate secondary metabolite production, such as BcbZIP134 decreased the biosynthesis of saikosaponin, VvbZIP36 promotes anthocyanin accumulation in grapevins [14]. Our precious study verified that SNO enhanced triterpenoid production using BpGSNOR transgenic B. platyphylla seedlings by RNAi silencing and GSNOR inhibitor N6022, and SNO also significantly increased gene expression of BpbZIP26. To investigate the function of BpbZIP26 in triterpenoid synthesis, we cloned BpbZIP26 and tentatively verified BpbZIP26 mediated triterpenoid production under control and N6022 treatment using Agrobacterium-mediated transient transformation, which has been proved by experiment that the results of transient transformation were consistent with that based on stable transformation in B. platyphylla [29]. The above result will provide gene resources for further improving the content of triterpenoid in B. platyphylla.

Conclusion

We identified 51 BpbZIPs in the B. platyphylla through genome-wide study, and divided into 13 subgroups according to the classification of A. thaliana bZIP proteins. All BpbZIP genes were unevenly distributed on 14 chromosomes, and12 duplication events were detected in the B. platyphylla genome. N6022 treatment changed gene expression levels of most BpbZIPs in leaves, stems, and roots, and gene expression levels of BpbZIP26 in all tissues of B. platyphylla was significantly enhanced under N6022 treatment. BpbZIP26 mediated triterpenoid production, and N6022 treatment further enhanced triterpenoid production in BpbZIP26 overexpression calli of B. platyphylla using Agrobacterium-mediated transient transformation.

Data availability

The data that support the finding of this study are available from the corresponding author upon reasonable request.

References

  1. Droge-Laser W, Snoek BL, Snel B, Weiste C. The Arabidopsis bZIP transcription factor family an update. Curr Opin Plant Biol. 2018;45:36–49.

    Article  Google Scholar 

  2. Wang LF, Zhu JF, Li XM, Wang SM, Wu J. Salt and drought stress and ABA responses related to bZIP genes from V. radiata and V. angularis. Gene. 2018;651:151–60.

    Article  Google Scholar 

  3. Jing YN, Yu Y, Wang HZ, Wu Y, Li CH. Genome-wide identification and expression analysis of the bZIP gene family in silver birch (Betula pendula Roth.). J For Res. 2022;33(5):1615.

    Article  CAS  Google Scholar 

  4. Wei K, Chen J, Wang Y, Chen Y, Chen S, Lin Y, Pan S, Zhong X, Xie D. Genome-wide analysis of bZIP-encoding genes in maize. DNA Res. 2012;19(6):463–76.

    Article  CAS  Google Scholar 

  5. Fan L, Xu L, Wang Y, Tang M, Liu L. Genome- and transcriptome-wide characterization of bZIP gene family identifies potential members involved in abiotic stress response and anthocyanin biosynthesis in radish (Raphanus sativus L.). Int J Mol Sci. 2019;20(24):6334.

  6. Zhao K, Chen S, Yao W, Cheng Z, Zhou B, Jiang T. Genome-wide analysis and expression profile of the bZIP gene family in poplar. BMC Plant Biol. 2021;21:122.

    Article  CAS  Google Scholar 

  7. Sánchez-Vicente I, Fernández-Espinosa M, Lorenzo O. Nitric oxide molecular targets: reprogramming plant development upon stress. J Exp Bot. 2019;70:4441–60.

    Article  Google Scholar 

  8. Gupta KJ, Kaladhar VC, Fitzpatrick TB, Fernie AR, Møller IM, Loake GJ. Nitric oxide regulation of plant metabolism. Mol Plant. 2022;15:228–42.

    Article  CAS  Google Scholar 

  9. Hussain A, Yun BW, Kim JH, Gupta KJ, Hyung NI, Loake GJ. Novel and conserved functions of S-nitrosoglutathione reductase in tomato. J Exp Bot. 2019;70(18):4877–86.

    Article  CAS  Google Scholar 

  10. Dröge-Laser W, Snoek BL, Snel B, Weiste C. The Arabidopsis bZIP transcription factor family-an update. Curr Opin Plant Biol. 2018;45:36–49.

    Article  Google Scholar 

  11. Liu H, Su J, Zhu Y, Yao G, Allan AC, Ampomah-Dwamena C, Shu Q, Lin-Wang K, Zhang S, Wu J. The involvement of PybZIPa in light-induced anthocyanin accumulation via the activation of PyUFGT through binding to tandem G-boxes in its promoter. Hortic Res. 2019;6:134.

    Article  CAS  Google Scholar 

  12. Ma K, Jiang Y, Yu ZY, Huang YT, Zhan YG, Fan GZ. H2S-induced NO/SNO positively promotes betulin production in Betula platyphylla. Ind Crops Prod. 2019;140(C):111608.

  13. Fan GZ, Nie TT, Huang YT, Zhan YG. GSNOR deficiency enhances betulin production in Betula platyphylla. Trees. 2018;32(3):847–53.

    Article  CAS  Google Scholar 

  14. Tu M, Fang J, Zhao R, Liu X, Yin W, Wang Y, Wang X, Wang X, Fang Y. CRISPR/Cas9-mediated mutagenesis of VvbZIP36 promotes anthocyanin accumulation in grapevine (Vitis vinifera). Hortic Res. 2022;9:022.

    Article  Google Scholar 

  15. Wang S, Zhang X, Li B, Zhao X, Shen Y, Yuan Z. Genome-wide identification and characterization of bZIP gene family and cloning of candidate genes for anthocyanin biosynthesis in pomegranate (Punica granatum). BMC Plant Biol. 2022;22(1):170.

    Article  CAS  Google Scholar 

  16. Chen S, Wang YC, Yu LL, Zheng T, Wang S, Yue Z, Jiang J, Kumari S, Zheng CF, Tang HB, Li J, Li YQ, Chen JJ, Zhang WB, Kuang HH, Robertson JS, Zhao PX, Li HY, Shu SQ, Yordanov YS, Huang HJ, Goodstein DM, Gai Y, Qi Q, Min JM, Xu CY, Wang SB, Qu GZ, Paterson AH, Sankoff D, Wei HR, Liu GF, Yang CP. Genome sequence and evolution of Betula platyphylla. Hortic Res. 2021;8:37.

    Article  CAS  Google Scholar 

  17. Liu HM, Yu ZY, Fan GZ, Zheng BJ. Genome-level analysis of BpR2R3-MYB family genes transcribed in seedlings of Betula platyphylla and BpR2R3-MYB15 enhanced flavonoid production. Chem Biol Technol Agric. 2022;9:37.

    Article  CAS  Google Scholar 

  18. Chen CJ, Chen H, Zhang Y, Thomas HR, Frank MH, He YH, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant. 2020;13:1194–202.

    Article  CAS  Google Scholar 

  19. Jiang Y, Sun FF, Zhan YG, Fan GZ. Effect of carbon monoxide on growth and triterpenoid production in Betula platyphylla suspension cells. Chin Tradit Herbal Drugs. 2019;50(15):3681–6.

    Google Scholar 

  20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-△△Ct method. Methods. 2001;25:402–8.

    Article  CAS  Google Scholar 

  21. Yang XY, Li J, Guo T, Guo B, An XM. Comprehensive analysis of the R2R3-MYB transcription factor gene family in populus trichocarpa. Ind Crops Prod. 2021;168: 113614.

    Article  CAS  Google Scholar 

  22. Liu JY, Chen NN, Chen F, Cai B, Dal Santo SD, Tornielli GB, Pezzotti M, Cheng ZM. Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera). BMC Genomics. 2014;15:281.

    Article  Google Scholar 

  23. Yang YX, Li JW, Li H, Yang YG, Guang YL, Zhou Y. The bZIP gene family in watermelon: genome-wide identification and expression analysis under cold stress and root-knot nematode infection. Peer J. 2019;7: e7878.

    Article  Google Scholar 

  24. Duan LL, Mo ZJ, Fan Y, Li KY, Yang MF, Li DC, Ke YZ, Zhang Q, Wang FY, Fan Y, Liu RX. Genome-wide identification and expression analysis of the bZIP transcription factor family genes in response to abiotic stress in Nicotiana tabacum L. BMC Genomics. 2022;23:318.

    Article  CAS  Google Scholar 

  25. Fan Lx, Xu L, Wang Y, Tang MJ, Liu LW. Genome- and transcriptome-wide characterization of bZIP gene family identifies potential members involved in abiotic stress response and anthocyanin biosynthesis in radish (Raphanus sativus L.). Int J Mol Sci. 2019;20:6334.

  26. Ma M, Chen QM, Dong HZ, Zhang SL, Huang XS. Genome-wide identification and expression analysis of the bZIP transcription factors, and functional analysis in response to drought and cold stresses in pear (Pyrus breschneideri). BMC Plant Biol. 2021;21:583.

    Article  CAS  Google Scholar 

  27. Li DY, Fu FY, Zhang HJ, Song FM. Genome-wide systematic characterization of the bZIP transcriptional factor family in tomato (Solanum lycopersicum L.). BMC Genomics. 2015;16:771.

  28. Zhang M, Liu YH, Shi H, Guo ML, Chai MN, He Q, Yan MK, Cao D, Zhao LH, Cai HY, Qin Y. Evolutionary and expression analyses of soybean basic Leucine zipper transcription factor family. BMC Genomics. 2018;19:159.

    Article  Google Scholar 

  29. Jia YQ, Niu YN, Zhao HM, Wang ZB, Gao CQ, Wang C, Chen S, Wang YC. Hierarchical transcription factor and regulatory network for drought response in Betula platyphylla. Hortic Res. 2022;9:040.

    Article  Google Scholar 

Download references

Funding

This work was supported by the National Natural Science Foundation of China (32171829), Heilongjiang Touyan Innovation Team Program (Tree Genetics and Breeding Innovation Team).

Author information

Author notes

  1. Bo Wang and Haixin Yang have contributed equally to this work

Authors and Affiliations

  1. Key Laboratory of Saline-Alkali Vegetation Ecology Restoration, Ministry of Education, Northeast Forestry University, Harbin, 150040, China

    Bo Wang, Xinglei Gao, Haixin Yang, Huimin Liu & Guizhi Fan

Authors
  1. Bo Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Xinglei Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Haixin Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Huimin Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Guizhi Fan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Gui-Zhi Fan, Huinin-Liu, and Xing-lei Gao wrote the main manuscript text and Bo Wang and Hai-xin Yang prepared Figs. 1–7. All authors reviewed the manuscript.

Corresponding author

Correspondence to Guizhi Fan.

Ethics declarations

Ethics approval and consent to participate

This manuscript is an original paper and has not been published in other journals. The authors agreed to keep the copyright rule.

Consent for publication

The authors agreed to the publication of the manuscript in this journal.

Competing interests

The authors declare no conflict of interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Table S1. Sequences of primer pairs of housekeeping genes for quantitative real-time RT-PCR assay. Table S2 Sequences of primer pairs of BpbZIPs for quantitative real-time RT-PCR assay. Fig. S1 Electrophoresis chart of PCR products of BpbZIP26 in B. platyphylla. Fig. S2 Amino acid sequences of BpbZIP26 in B. platyphylla.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, B., Gao, X., Yang, H. et al. Characteristic analysis of BpbZIP family genes and BpbZIP26 significantly enhanced triterpenoid production in Betula platyphylla under S-nitrosothiol treatment. Chem. Biol. Technol. Agric. 9, 97 (2022). https://doi.org/10.1186/s40538-022-00359-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40538-022-00359-3

Keywords