Skip to main content
Chemical and Biological Technologies in Agriculture
Download PDF
Download ePub

Effects of bacterial inoculants on the microbial community, mycotoxin contamination, and aerobic stability of corn silage infected in the field by toxigenic fungi

Chemical and Biological Technologies in Agriculture volume 9, Article number: 93 (2022) Cite this article

Abstract

This study aimed to evaluate the effects of inoculants on the microbial community and mycotoxins contamination of corn silage during aerobic exposure. Whole-crop corn infected with or without mycotoxigenic fungi were ensiled with Lentilactobacillus buchneri (LB, 1.0 × 106 cfu/g fresh weight (FW)), Lactiplantibacillus plantarum (LP, 1.0 × 106 cfu/g FW), or LBLP at 1.0 × 106 cfu/g FW each. The concentration of acetic acid (AcA) (P < 0.05) in LB and LBLP silages was higher than in control (C) and LP of non-fungal infection (NFI) silages. The fungal infection resulted in a larger increase of zearalenone (ZEN, P = 0.01), fumonisin B1 (FUB1, P = 0.02), and fumonisin B2 (FUB2, P = 0.02). The relative abundance (RA) of Issatchenkia in NFI was higher (P < 0.001) than FI silages, whereas the RA of Kazachstania (P < 0.001), Zygosaccharomyces (P = 0.047), and Candida (P = 0.025) in NFI were lower than these of FI silages. The aerobic stability was improved by the application of LB and LBLP as compared with the C of NFI silages. The LB and LBLP had the potential to improve aerobic stability and alleviate mycotoxins contamination of non-fungal infected corn silages.

Graphical Abstract

Introduction

Whole-crop corn silage is currently the predominant conserved forage in dairy systems worldwide, however, it is prone to aerobic spoilage during the feed-out phase [1]. Molds, together with yeasts, are believed to be responsible for the aerobic spoilage of silages. Although most yeast and molds were inhibited during the ensiling, the dominant fermented organic acids showed more fungistatic rather than fungicidal effects [2]. Thus, some acid-tolerant fungi can revive and aggressively proliferate when silage was exposed to air, resulting in poor aerobic stability and mycotoxin contamination. Mycotoxin contamination in food and feed is an ongoing global concern because it is currently recognized as a production constraint and a major animal health risk [3]. Fungal infection and mycotoxins contamination are impossible to entirely avoid during growing and storing forages for cattle [4]. The oxygen-rich microenvironment was usually distributed on the surface and edge of the silo where visible green-gray mold indicative of mycotoxin production, including aflatoxins and several Fusarium mycotoxins, were usually visible [5, 6].

Inoculating L. buchneri is a common practice to improve the bio-preservation and aerobic stability of corn silage because it can delay the development of spoilage yeasts and molds [7]. Apart from improvement in fermentation profiles and aerobic stability, some LAB had the potential to reduce mycotoxins contamination in silages [8]. Ma et al. [9] reported that inoculation of L. plantarum or L. buchneri decreased linearly the aflatoxin B1 (AFB1) concentration within 3 d of ensiling. However, it is not clear whether their antifungal and anti-mycotoxigenic activities could last to the feed-out phase of silages. L. buchneri has been used widely to enhance the aerobic stability of silages because of its heterofermentative nature [10]. Most of the studies aimed at assessing the effects of L. buchneri on the aerobic stability of corn silages under normal conditions and a few studies have been conducted on suboptimal conditions (i.e., corn infected by mold in the field) [7].

We hypothesized that infected toxigenic fungi could revive and proliferate during aerobic exposure, while inoculant LAB could mitigate the potential negative effect of fungal infection on aerobic stability and hygienic quality of corn silage. Therefore, the study aimed to evaluate the effects of L. buchneri and L. plantarum on the aerobic stability of corn silage, which was artificially infected by toxigenic fungi in the field.

Materials and methods

Crop and ensiling

Two toxigenic fungi Aspergillus flavus and Fusarium graminearum were cultured on potato dextrose agar (PDA, Shanghai Bio-way Technology Co., Ltd) medium at 30 °C under aerobic conditions to fully sporulate. Spores were harvested with sterile glass slides and diluted with 0.1% Tween-80 (V/V) fortified sterile distilled water, followed by filtering with sterile 4-layer gauze to obtain a spore suspension. Then spore suspension was adjusted to a final concentration of approximately 106 cfu/mL. Corn was grown in the experimental field (total of 10 plots) of Nanjing Agricultural University (32.04 °N, 118.88 °E, Nanjing, China). At the silking stage of corn, 5 plots were randomly selected, and the prepared fungal spore mixture (5 mL per plant) was sprayed on ears, husks, silk, and leaves with a vacuum hand sprayer for artificial infection. After 2 weeks, the same plots of corn were artificially infected with the same procedure again.

Fungal infection (FI) and non-fungal infection (NFI) corn at the 1/2 milk line stage were harvested and chopped to a theoretical length of 2–3 cm. The 5 plots were harvested separately to obtain 5 replicates, and the fresh corn of each plot was divided into 4 piles. Both FI and NFI corn was treated either without (C, untreated), or with L. plantarum (LP, applied at 1.0 × 106 cfu/g fresh weight (FW)), L. buchneri (applied at LB, 1 × 106 cfu/g FW), and combination of L. plantarum and L. buchneri (LBLP, L. plantarum and L. buchneri applied at 0.5 × 106 cfu/g FW each). Then about 3.5 kg of treated corn (DM, 336 ± 6.4 g/kg FW) was filled into a plastic silo (5 L), which was sealed and stored for 90 d at an ambient temperature (24 ± 2 °C).

Aerobic stability test

After 90 d of ensiling, all silages of each silo were emptied and mixed thoroughly, followed by filling into a new large plastic silo (capacity 15 L) without compaction and uncovered, which was stored at ambient temperature (24 ± 2 ℃) for 6 d. The silage was sampled on d 0, 2, 4, and 6 d of aerobic exposure. The room and silage temperatures were measured half-hourly by a data logger. Aerobic stability was defined as the number of hours the silage remained stable before its temperature increased by 2 °C above the ambient temperature [11].

Sample preparation and chemical analyses

The silages were split into four subsamples. One subsample (20 g) was extracted with 60 g of distilled water at 4 °C for 24 h, followed by filtering through four layers of medical gauze. The pH of the silage filtrate was immediately determined using a pH meter (HANNA pH 211, Hanna Instruments Italia Srl, Padova, Italy). Subsequently, one aliquot of silage extract was centrifuged at 10,000×g for 10 min at 4 °C, and the supernatant was reserved for lactic acid (LA), acetic acid (AcA), and ethanol (EOL) analyses, which were quantified following the protocol of Romero et al. [12].

One subsample of silage was oven-dried at 65 °C to constant weight for determining DM content. Dried samples were ground to pass through a 1-mm screen for water-soluble carbohydrate (WSC) and mycotoxins analyses. The WSC content was analyzed by colorimetry after reaction with anthrone reagent. The concentrations of aflatoxins (AFs), zearalenone (ZEN), deoxynivalenol (DON), and fumonisins were quantified using an ultra-performance liquid chromatography–tandem mass spectrometry system with a Sciex QTRAP® 5500 triple quadruple tandem mass spectrometer (UPLC–MS/MS) (Sciex, Foster City, CA, USA) [13].

Microbial community analyses

One subsample (10 g) was shaken with 90 mL sodium chloride sterile saline (0.85%) at 150 rpm. One aliquot of the solution was tenfold serially diluted to count the microorganisms, and another aliquot of the solution was filtered through four layers of medical gauze for microbial DNA extraction. The LAB was determined on de Man, Rogosa, and Sharpe agar after 48 h of anaerobic incubation at 37 °C. The number of yeasts and molds was counted on the PDA medium after 48–72 h of aerobic incubation at 28 °C. The microbial data were obtained and transformed to log10 for presentation and statistical analysis.

Three replicates of silages sampled from d 0 and 6 of aerobic exposure were randomly chosen for bacterial and fungal community analyses. Microbial DNA from various solutions was extracted with Fast DNA SPIN Kit for Soil (MP Biomedicals, Solon, OH, USA). The Universal primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify bacterial 16S rRNA V3–V4 regions, while fungal ITS was amplified with primers ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and ITS2aR (5′-GCTGCGTTCTTCATCGATGC-3′). Then purified PCR amplicons were paired-end sequenced using the Illumina MiSeq PE300 platform (Illumina Inc., San Diego, CA, USA). Paired-end reads were merged and checked by FLASH (Version 1.2.11), and the primers were trimmed using QIIME (Version 1.7.0). Operation taxonomic units (OTUs) were done using open reference clustered with a 97% similarity cutoff using UPARSE (Version 7.1 http://drive5.com/uparse/). Then the chimeric sequences were identified and removed using UCHIME. Alpha-diversity estimates (numbers of observed OUT, Chao1, and Shannon) and beta-diversity evaluation, based on principal coordinate analysis (PCoA), were performed using the Phyloseq and Vegan packages on R. Bacterial and fungal communities at the phylum and genus levels were analyzed based on Silva database with a confidence threshold of 70%. The high-throughput sequencing data were analyzed on the free online platform of Majorbio I-Sanger Cloud Platform (www.i-sanger.com). All DNA sequences have been deposited in the NCBI Short Read Archive database under BioProject PRJNA823478.

Statistical analyses

Data were analyzed using the GLM procedure of SAS (Version 9.3, SAS Institute, Cary, NC, USA). The fermentation profiles and microbial community diversity were analyzed as a split plot in a randomized complete block design with fixed effects of fungal infection (F), inoculation (I), aerobic duration (D), and their interaction. The treatments and aerobic duration were considered as main- and sub-plots, respectively. Data on aerobic stability and mycotoxins concentrations were analyzed as a completely randomized design with fungal infection and inoculation as the main factors. Tukey’s test was employed to compare the differences among treatments, and significance was declared at P < 0.05.

Results

Fermentation profiles of corn silages during aerobic exposure

There was an F × I × D interaction for pH (P = 0.002), LA (P < 0.001), and AcA (P = 0.008) concentrations (Fig. 1 and Table 1). The pH of FI silages increased faster and was higher than those of NFI silages over 6 d of aerobic exposure (P = 0.008). For NFI silages, the pH in LBLP began to lower (P < 0.05) than other silages from d 4. For FI silages, the inoculants decreased pH value compared with C on d 4 (P < 0.05), however, their effects disappeared on d 6. The LA concentration of FI silages decreased faster than that of NFI silages. For FI silages, the LP and LBLP silages showed lower (P < 0.05) LA concentration than C and LB on d 4. For NFI silages, the higher (P < 0.05) LA concentration in inoculants treated silage than C was only observed on d 6. FI silages had lower AcA concentrations (P < 0.05) than NFI silages over 6 d of aerobic exposure. For FI silages, the higher (P < 0.05) concentration of AcA in LB and LBLP silages than in C and LP lasted until d 2 and 4, respectively.

Fig. 1
figure 1

Changes in pH, lactic acid, and acetic acid concentration in non-fungal infection (left) and fungal infection (right) of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; DM, dry matter

Full size image
Table 1 Probability of the effects of fungal infection, inoculants, days of aerobic exposure, and their interactions on chemical composition, fermentation products, and microbial populations of corn silage (n = 5)
Full size table

As shown in Fig. 2, WSC concentration decreased (P < 0.001) over 6 d of aerobic exposure regardless of fungal infection. FI silages showed lower (P < 0.001) WSC concentration than NFI silages. The WSC concentrations in C and LP were lower (P < 0.01) than those of LB and LBLP for NFI silages after d 6. There was an F × I × D interaction for the concentration of EOL (P < 0.001). For NFI silages, the EOL concentration gradually (P > 0.05) decreased and there was no significant difference (P > 0.05) among NFI silages over 6 d of aerobic exposure. For FI silages, there was a slight increase in EOL concentration within 2 d followed by a rapid drop, and LP and LBLP silages had lower EOL concentrations than C and LB on d 4 (P < 0.05).

Fig. 2
figure 2

Changes in water-soluble carbohydrates and ethanol concentrations in non-fungal infection (left) and fungal infection (right) of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; DM, dry matter

Full size image

The F × D and I × D interactions (P < 0.001) were detected for LAB counts (Fig. 3). The LAB counts in both NFI and FI silages increased slightly during the initial 2 d of aerobic exposure, followed by a gradual decrease in FI silages until d 6, while that in NFI rapidly decreased after 4 d of aerobic exposure. The LBLP of NFI silages had the lowest LAB counts on d 6, while there was no significant difference in LAB counts among FI silages during aerobic exposure. The I × D and F × D interactions were observed for yeast and mold counts. The count of yeasts and molds in FI silages increased faster and remained at higher levels than that of NFI silages. The inoculants decreased (P < 0.05) the counts of yeasts and molds compared with C of FI silages after 6 d of aerobic exposure, however, there was no significant difference (P > 0.05) in yeasts and molds counts among NFI silages during the 6 d of aerobic exposure.

Fig. 3
figure 3

Changes in lactic acid bacteria, yeasts and mold in non-fungal infection (left) and fungal infection (right) of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; FW, fresh weight

Full size image

Bacterial and fungal communities of corn silages during aerobic exposure

A total of 2,294,390 and 2,948,299 reads were obtained by high-throughput amplicon sequencing of bacterial 16S rRNA and fungal ITS genes, respectively. The Chao1 and Shannon indices of bacterial and fungal communities decreased after 6 d of aerobic exposure, and inoculants reduced the Chao 1 and Shannon indices in NFI silages but did not affect those of FI silages (Additional file 1: Figs. S1 and S2).

Changes in bacterial and fungal communities at the genus level during aerobic exposure are shown in Fig. 4A. Acetobacter (57.1%), Lactobacillus (27.4%), Acinetobacter (2.95%), Klebsiella (1.93%), and Enterobacter (1.31%) were the dominant bacterial genus in corn silages. The relative abundance (RA) of Acetobacter, Lactobacillus, Klebsiella, and Enterobacter were neither affected (P > 0.05) by fungal infection nor inoculation. During 6 d of aerobic exposure, the RA of Acetobacter in silage increased (P < 0.001), while the RA of Lactobacillus (P < 0.001), Klebsiella (P = 0.003), and Enterobacter (P < 0.001) significantly decreased. There was an F × I interaction (P = 0.007) for the RA of Acinetobacter because it was the greatest (P < 0.05) in C among NFI silages, but it was the lowest in C among FI silages.

Fig. 4
figure 4

Bacterial (A) and fungal (B) community at the genus level in non-fungal infection and fungal infection of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; Arabic number indicating days of aerobic exposure; FW, fresh weight

Full size image

The fungal genera including Issatchenkia (52.3%), Kazachstania (18.1%), Zygosaccharomyces (9.78%), Candida (7.14%), Aspergillus (2.23%), and Pichia (1.96%) were the dominant fungal genera in corn silages during aerobic exposure. The RA of Issatchenkia was higher (P < 0.001) in NFI than in FI silages, whereas the RA of Kazachstania (P < 0.001), Zygosaccharomyces (P = 0.047), Candida (P = 0.025), and Pichia (P = 0.013) in NFI were lower than in FI silages. There was an F × D interaction for the RA of Issatchenkia (P = 0.013), Candida (P < 0.001), and Pichia (P < 0.001) because they were significantly (P < 0.01) decreased for FI silages, but there were no marked changes for NFI silages during aerobic exposure. The F × I interaction was also found for RA of Kazachstania (P < 0.001) and Zygosaccharomyces (P < 0.001). The RA of Kazachstania and Zygosaccharomyces in FI silages significantly (P < 0.01) increased during aerobic exposure, but there were no significant changes except C for NFI silages.

Correlation relationship between microbial community and fermentation profiles

For NFI silages, redundancy analysis (RDA) indicated that the microbial community of silage was greatly affected by pH, LA, EOL, WSC, and AcA (Fig. 5A). Lactobacillus was positively correlated with WSC, LA, and AcA, while negatively correlated with pH in NFI silages. Positive correlations were found between Issatchenkia and WSC, LA, and AcA, while a negative correlation between Issatchenkia and pH was observed. For FI silages (Fig. 5B), the WSC, EOL, LA, and AcA concentrations were positively correlated with Lactobacillus, Issatchenkia, and Candida, while negatively correlated with Kazachstania, Zygosaccharomyces, and Acetobacter. The pH was positively correlated with Kazachstania, Zygosaccharomyces, and Acetobacter for FI silages.

Fig. 5
figure 5

Redundancy analysis (RDA) of the effect of compost parameters (abiotic factors: red arrows; biotic factors: blue arrows) on bacterial and fungal taxonomic distribution in non-fungal infection (A) and fungal infection (B) of corn silage during aerobic exposure. LA, lactic acid; AcA, acetic acid; EOL, ethanol; WSC, water-soluble carbohydrates; C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW. 0 d, after silo opening; 6 d, after 6 days of aerobic exposure; FW, fresh weight

Full size image

Mycotoxins concentrations in corn silages

As shown in Fig. 6, there were F × I interactions for AFB1 (P = 0.03) and AFB2 (P = 0.02), because the increase of AFB1 in C was larger (P < 0.05) than other treatments for NFI silages but there was no significant difference in AFB1 concentration among FI silages. The change of AFB2 was similar among all silages for NFI silage, while the decline of AFB2 was only (P < 0.05) found in LB of FI silages. The FI silages showed larger increases of ZEN (P = 0.01), FUB1 (P = 0.02), and FUB2 (P = 0.02) than NFI silages. The increase of ZEN in LP was the smallest (P < 0.05) among all FI silages. The concentrations of FUB1 (P = 0.15) and FUB2 (P = 0.89) were not affected by inoculation. Neither inoculation nor fungal infection affected the concentration of DON.

Fig. 6
figure 6

Changes in relative concentrations of mycotoxins in corn silage during aerobic exposure. NFI, non-fungal infection; FI, fungal infection. I, inoculation; F, fungal infection; C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; DM, dry matter; FW, fresh weight

Full size image

Aerobic stability of corn silages

There was a F × I interaction (P < 0.001) for the aerobic stability (Fig. 7). The aerobic stability of LB (82 h) and LBLP (85 h) was longer than that of C (62 h) for NFI silages, however, there was no significant difference (P > 0.05) in aerobic stability among FI silages. The fungal infection enhanced aerobic deterioration compared with NFI silages (P < 0.001).

Fig. 7
figure 7

The aerobic stability (h) of corn silage after 6 days aerobic exposure. Aerobic stability was defined as a 2 °C increase in temperature over the established baseline temperature. SEM = 6.04. NFI, non-fungal infection; FI, fungal infection. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW; FW, fresh weight

Full size image

Discussion

Effect of inoculant and fungal infection on the fermentation profiles and mycotoxins of corn silages during aerobic exposure

Once the silage is opened, aerobic microorganisms that survived during the ensiling process, e.g., bacilli, yeast, and acid-tolerant bacteria, can rapidly proliferate and metabolize residual sugars and organic acids to CO2, H2O, and heat [14, 15]. Consequently, silage temperature increases and the silage mass becomes aerobically unstable. The consumption of acids by aerobic microorganisms is accompanied by the increase in silage pH, thus, the variation of silage pH is used as the criteria for aerobic deterioration [16]. During the initial 2 d of aerobic exposure, the pH of NFI silages showed a slight increase followed by a marked increase, while that in FI silages rapidly increased. This might be attributed to the rapid revival of aerobic microorganisms including infected toxigenic fungi [16]. This hypothesis was confirmed by the changes in LA: the LA in FI sharply decreased once aerobic exposure, while the rapid drop of LA was following a transient stable (2 d) in NFI silages. Kung, et al. [17] also reported that the increase in silage pH was accompanied by a decline of LA in corn silages during aerobic exposure. The faster and larger changes of pH and LA in FI than in NFI silages were related to its lower AcA concentration. The AcA has been proven to be responsible for enhancing aerobic stability because it acts as an inhibitor of spoilage organisms. Danner, et al. [18] stated that the silage aerobic stability increased exponentially with acetic acid concentration. Queiroz, et al. [19] also found that fungal infection negatively affected the fermentation of corn silage and resulted in a lower AcA concentration, which could explain the poor aerobic stability of FI silages in the present study.

Although other modes of action may exist, the production of AcA has been the most accepted explanation of how organisms from the Lb. buchneri group of bacteria increases the aerobic stability of silages [7]. In the study, the higher AcA concentrations in LB and LBLP than in other treatments of NFI silages lasted to d 2 and 4, respectively, while no significant difference in AcA concentrations was observed among FI silages. This indicated that the fungal infection might disturb the microbial community and fermentation of silages, diminishing the effect of LB on AcA production. The decline in WSC contents along with the aerobic exposure progress was attributed to the extensive proliferation of aerobic microorganisms, which can oxidize WSC to CO2 and H2O [20]. The FI silages always had lower WSC concentrations than NFI silages. It can be conjectured that infected fungi consumed more WSC during the initial transient aerobic stage of ensiling, resulting in the lower residual WSC being in FI silages than NFI silages. For NFI silages, the concentration of WSC in LB and LBLP was consistently higher than that of C and LP over the 6 d of aerobic exposure. This was attributed to the more AcA produced by L. buchneri, which inhibited the proliferation of undesirable microorganisms, preserving more residual WSC [21]. Kung, et al. [22] reported that higher dissociation constants (pKa) of AcA (4.75) than LA (3.86) contributed to the higher antimicrobial activity of AcA in surroundings where the pH values are low (around pH 4). In the study, there was a transient increase in the ethanol concentration of FI silages, which was possibly due to the metabolism of yeast within the initial 2 d of aerobic exposure. The FI silages had a higher number of yeasts and molds than the NFI silages. Irrespective of fungal infection, the lower numbers of yeast and molds in LB and LBLP than C and LP on d 2 and 4 were attributed to the fungistatic property of AcA produced by the inoculants of L. buchneri [2]. The gradual decline of ethanol concentration with the aerobic exposure progress, might be due to its volatilization or metabolized by Acetobacter [23].

Effect of inoculant and fungal infection on the bacterial and fungal communities of corn silages

During aerobic exposure, the application of LAB reduced the Shannon and Chao 1 indexes of bacterial and fungal communities in NFI silages, but not in FI silages. This might be due to the proliferation of aerobic bacteria and yeasts, which occupied the predominant roles of the microbial community [20].

In the study, Acetobacter became the dominant bacteria after 6 d of aerobic exposure, because it can oxidize ethanol to AcA initially, followed by oxidation of LA and AcA to CO2 and H2O [24]. Acetobacter is non-fermenting aerobic bacteria and can be found in various environments, it can initiate aerobic deterioration of corn silage with or without the presence of yeasts [25]. Guan, et al. [26] also observed a significant increase in the RA of Acetobacter in Napier grass after 2 d of aerobic exposure. Lactobacillus is the main bacteria involved in LA fermentation during ensiling and usually dominates the well-fermented silages [27], however, it is rapidly replaced by aerobic bacteria (e.g., Acetobacter spp.) once silage is exposed to air [28]. In the present study, the RA of Lactobacillus reduced below 1% in silage except for C and LB of NFI silages after 6 d of aerobic exposure. The genus Klebsiella and Enterobacter, belonging to enterobacteria, are capable to produce ammonia, which can cause animal health issues [29]. In the study, the decline of RA of Klebsiella and Enterobacter might be attributed to the anaerobic property and intolerance to acid conditions, as reported by McGarvey, et al. [30], who found Enterobacteriaceae could thrive in anaerobic and weak-acidic conditions (pH > 5.4). In the study, the silage pH was not increased up to 5.4 until d 6 of aerobic exposure, which resulted in the substitution of Klebsiella and Enterobacter by Acetobacter. The higher RA of Acinetobacter in NFI than in FI silages might be related to the higher AcA concentration, which could be used by Acinetobacter as a substrate [31].

Issatchenkia, an acid-tolerant yeast, is the dominant fungal genus in NFI silages regardless of aerobic exposure or inoculation. However, there are marked variations in fungal composition for FI silages during 6 d of aerobic exposure. This discrepancy between NFI and FI silages was attributed to the fungal infection, which resulted in more yeast and molds present and revived in FI silages during aerobic exposure. For FI silages, the marked decline in the RA of Issatchenkia was accompanied by the increase of RA of Kazachstania and Zygosaccharomyces during 6 d of aerobic exposure. Wang, et al. [32] indicated that Kazachstania had a strong tolerance to LA and was crucially involved in initiating the aerobic deterioration of corn silage with a relatively low pH and AcA content. Hao, et al. [33] reported that Zygosaccharomyces bailii was the sole yeast species isolated from spoilage total mixed ration (TMR) silages and confirmed that the Z. bailii could initiate aerobic deterioration of TMR silages. In the study, the RA of Candida and Pichia decreased below 1% after 6 d of aerobic exposure, this is in contrast to the report by Duniere, et al. [34], who found that Candida and Pichia were the main spoilage genera after aerobic exposure. Pahlow, et al. [35] indicated that Issatchenkia, Candida, and Pichia are lactate-assimilating yeasts that are the initiators of aerobic degradation of silage. We speculated that Kazachstania and Zygosaccharomyces underwent more vigorous growth and outcompeted other yeast and molds.

The correlation between microbial community and fermentation profiles was analyzed by RDA. In the present study, bacterial genera such as Lactobacillus were found to be positively correlated with LA and AcA, while Acetobacter was negatively correlated with LA and AcA regardless of fungal infection. When silage is exposed to air, LA and AA were metabolized by aerobic bacteria, increasing silage pH, which further inhibited the proliferation of Lactobacillus and boosted the dominance of Acetobacter [36]. Fungal genera Kazachstania and Zygosaccharomyces were negatively correlated with LA and were positively correlated with pH. This indicated that Kazachstania and Zygosaccharomyces were considered dominant fungi during aerobic exposure, which could assimilate lactate and increase pH, initiating the spoilage of silages.

Effect of inoculant and fungal infection on mycotoxins of corn silages during aerobic exposure

In the study, the concentrations of most mycotoxins increased over 6 d of aerobic exposure, indicating that toxigenic fungi revived during aerobic exposure [37]. The larger increases of AFs, ZEN, and DON concentrations in FI than in NFI silages confirmed that artificially infected A. flavus and F. graminearum might revive and produce mycotoxins during aerobic exposure. Ferrero, et al. [38] indicated that the aerobic environment allowed the proliferation of A. flavus and enhanced the production of AFB1. Vandicke, et al. [39] also reported that some Fusarium species were even able to survive at low oxygen levels (< 0.5%). The fungal spores that survived in the silage may reactivate and produce Fusarium toxins due to exposure to oxygen during feed-out.

The more effective of inoculants on reducing AFB1 contamination in NFI than FI silages might be attributed to the revival of toxigenic fungi and higher mycotoxins in FI silages, which attenuated the effects of inoculants on reducing AFB1 contamination. Ma, et al. [9] reported that L. plantarum, L. buchneri, and Pediococcus acidilactici could bind to AFB1 in an in vitro medium. Dogi, et al. [40] suggested that inoculation with Lactobacillus rhamnosus strongly inhibited the fungal growth (F. graminearum, Aspergillus parasiticus, etc.) and mycotoxin production (AFs, ZEN, DON, etc.). However, it is unexplainable that the AFB2 in LB of FI silage was decreased during aerobic exposure in the study.

Effect of inoculants and fungal infection on aerobic stability of corn silages

The fungal infection shortened the aerobic stability of silages regardless of inoculation. This was attributed to the artificial fungal infection, which resulted in more yeast and molds surviving in FI than in NFI silages. Keshri, et al. [41] reported that the poor aerobic stability of corn silages was due to the high number of lactate-assimilating yeasts. In the study, the aerobic stability of NFI silages was improved by the application of LB and LBLP as compared with C of NFI silages. Kung, et al. [17] also found that inoculant containing L. buchneri could extend the aerobic stability of silages challenged with air stress, which was attributed to the antifungal property of AcA produced by L. buchneri. Romero, et al. [42] reported that applying a combination inoculant of L. buchneri and Pediococcus pentosaceus increased the AcA concentration and decreased yeasts and molds in corn silages, which in turn indirectly extended the aerobic stability.

Conclusion

The fungal infection disturbs the microbial community and silage fermentation, weakening the effect of LB on AcA production. Kazachstania and Zygosaccharomyces were dominant fungi and contributed to the aerobic spoilage of FI silages. There were larger increases of AFs, ZEN, and DON concentrations in FI than in NFI, and the inoculants showed more effect on reducing AFB1 contamination in NFI than in FI silages. The application of LB and LBLP inoculants improved the aerobic stability of corn silage, delayed the onset of aerobic deterioration, and reduced the risk of mycotoxins production after silo opening.

Availability of data and materials

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Benjamim da Silva E, Costa DM, Santos EM, Moyer K, Hellings E, Kung L Jr. The effects of Lactobacillus hilgardii 4785 and Lactobacillus buchneri 40788 on the microbiome, fermentation, and aerobic stability of corn silage ensiled for various times. J Dairy Sci. 2021;104(10):10678–98.

    Article  PubMed  CAS  Google Scholar 

  2. Kung L Jr, Smith ML, Benjamim da Silva E, Windle MC, da Silva TC, Polukis SA. An evaluation of the effectiveness of a chemical additive based on sodium benzoate, potassium sorbate, and sodium nitrite on the fermentation and aerobic stability of corn silage. J Dairy Sci. 2018;101(7):5949–60.

    Article  PubMed  CAS  Google Scholar 

  3. García-Díaz M, Gil-Serna J, Vázquez C, Botia MN, Patiño B. A comprehensive study on the occurrence of mycotoxins and their producing fungi during the maize production cycle in Spain. Microorganisms. 2020;8(1):141–55.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Smith LE, Stoltzfus RJ, Prendergast A. Food chain mycotoxin exposure, gut health, and impaired growth: a conceptual framework. Adv Nutr. 2012;3(4):526–31.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Cheli F, Campagnoli A, Dell’Orto V. Fungal populations and mycotoxins in silages: from occurrence to analysis. Anim Feed Sci Tech. 2013;183(1–2):1–16.

    Article  CAS  Google Scholar 

  6. Gallo A, Fancello F, Ghilardelli F, Zara S, Froldi F, Spanghero M. Effects of several lactic acid bacteria inoculants on fermentation and mycotoxins in corn silage. Anim Feed Sci Technol. 2021;277:114962.

    Article  CAS  Google Scholar 

  7. Muck RE, Nadeau EMG, McAllister TA, Contreras-Govea FE, Santos MC, Kung L Jr. Silage review: Recent advances and future uses of silage additives. J Dairy Sci. 2018;101(5):3980–4000.

    Article  PubMed  CAS  Google Scholar 

  8. Gallo A, Fancello F, Ghilardelli F, Zara S, Spanghero M. Effects of several commercial or pure lactic acid bacteria inoculants on fermentation and mycotoxin levels in high-moisture corn silage. Anim Feed Sci Technol. 2022;286:115256.

    Article  CAS  Google Scholar 

  9. Ma ZX, Amaro FX, Romero JJ, Pereira OG, Jeong KC, Adesogan AT. The capacity of silage inoculant bacteria to bind aflatoxin B1 in vitro and in artificially contaminated corn silage. J Dairy Sci. 2017;100(9):7198–210.

    Article  PubMed  CAS  Google Scholar 

  10. Ferrero F, Tabacco E, Piano S, Casale M, Borreani G. Temperature during conservation in laboratory silos affects fermentation profile and aerobic stability of corn silage treated with Lactobacillus buchneri, Lactobacillus hilgardii, and their combination. J Dairy Sci. 2021;104(2):1696–713.

    Article  PubMed  CAS  Google Scholar 

  11. Ranjit NK, Kung L Jr. The effect of Lactobacillus buchneri, Lactobacillus plantarum, or a chemical preservative on the fermentation and aerobic stability of corn silage. J Dairy Sci. 2000;83(3):526–35.

    Article  PubMed  CAS  Google Scholar 

  12. Yuan XJ, Yang X, Wang WB, Li JF, Dong ZH, Zhao J, et al. The effects of natamycin and hexanoic acid on the bacterial community, mycotoxins concentrations, fermentation profiles, and aerobic stability of high moisture whole-crop corn silage. Anim Feed Sci Technol. 2022;286:115250.

    Article  CAS  Google Scholar 

  13. Wang W, Yang X, Li J, Dong Z, Zhao J, Shao T, et al. Effects of hexanoic acid on microbial communities, fermentation, and hygienic quality of corn silages infested with toxigenic fungi. J Sci Food Agric. 2022;102(9):3522–34.

    Article  PubMed  CAS  Google Scholar 

  14. Drouin P, Tremblay J, Renaud J, Apper E. Microbiota succession during aerobic stability of maize silage inoculated with Lentilactobacillus buchneri NCIMB 40788 and Lentilactobacillus hilgardii CNCM-I-4785. Microbiologyopen. 2021;10(1):e1153.

    Article  PubMed  CAS  Google Scholar 

  15. Shan G, Buescher W, Maack C, Lipski A, Acir IH, Trimborn M, et al. Dual sensor measurement shows that temperature outperforms pH as an early sign of aerobic deterioration in maize silage. Sci Rep. 2021;11(1):8686.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. Wilkinson JM, Davies DR. The aerobic stability of silage: key findings and recent developments. Grass Forage Sci. 2013;68(1):1–19.

    Article  CAS  Google Scholar 

  17. Kung L Jr, Savage RM, da Silva EB, Polukis SA, Smith ML, Johnson ACB, et al. The effects of air stress during storage and low packing density on the fermentation and aerobic stability of corn silage inoculated with Lactobacillus buchneri 40788. J Dairy Sci. 2021;104(4):4206–22.

    Article  PubMed  CAS  Google Scholar 

  18. Danner H, Holzer M, Mayrhuber E, Braun R. Acetic acid increases stability of silage under aerobic conditions. Appl Environ Microbiol. 2003;69(1):562–7.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. Queiroz OCM, Kim SC, Adesogan AT. Effect of treatment with a mixture of bacteria and fibrolytic enzymes on the quality and safety of corn silage infested with different levels of rust. J Dairy Sci. 2012;95(9):5285–91.

    Article  PubMed  CAS  Google Scholar 

  20. Yuan XJ, Wen AY, Wang J, Desta ST, Dong ZH, Shao T. Effects of four short-chain fatty acids or salts on fermentation characteristics and aerobic stability of alfalfa (Medicago sativa L.) silage. J Sci Food Agric. 2018;98(1):328–35.

    Article  PubMed  CAS  Google Scholar 

  21. Romero JJ, Joo Y, Park J, Tiezzi F, Gutierrez-Rodriguez E, Castillo MS. Bacterial and fungal communities, fermentation, and aerobic stability of conventional hybrids and brown midrib hybrids ensiled at low moisture with or without a homo- and heterofermentative inoculant. J Dairy Sci. 2018;101(4):3057–76.

    Article  PubMed  CAS  Google Scholar 

  22. Kung L Jr, Shaver RD, Grant RJ, Schmidt RJ. Silage review: Interpretation of chemical, microbial, and organoleptic components of silages. J Dairy Sci. 2018;101(5):4020–33.

    Article  PubMed  CAS  Google Scholar 

  23. Carvalho BF, Ávila CLS, Miguel MGCP, Pinto JC, Santos MC, Schwan RF. Aerobic stability of sugar-cane silage inoculated with tropical strains of lactic acid bacteria. Grass Forage Sci. 2015;70(2):308–23.

    Article  CAS  Google Scholar 

  24. da Silva EB, Savage RM, Biddle AS, Polukis SA, Smith ML, Kung L. Effects of a chemical additive on the fermentation, microbial communities, and aerobic stability of corn silage with or without air stress during storage. J Anim Sci. 2020;98(8):1–11.

    Article  Google Scholar 

  25. Spoelstra SF, Courtin MG, Vanbeers JAC. Acetic-acid bacteria can initiate aerobic deterioration of whole crop maize silage. J Agric Sci. 1988;111:127–32.

    Article  Google Scholar 

  26. Guan H, Shuai Y, Ran Q, Yan Y, Wang X, Li D, et al. The microbiome and metabolome of Napier grass silages prepared with screened lactic acid bacteria during ensiling and aerobic exposure. Anim Feed Sci Technol. 2020;269:114673.

    Article  CAS  Google Scholar 

  27. McAllister TA, Duniere L, Drouin P, Xu S, Wang Y, Munns K, et al. Silage review: Using molecular approaches to define the microbial ecology of silage. J Dairy Sci. 2018;101(5):4060–74.

    Article  PubMed  CAS  Google Scholar 

  28. Guan H, Ran Q, Li H, Zhang X. Succession of microbial communities of corn silage inoculated with heterofermentative lactic acid bacteria from ensiling to aerobic exposure. Fermentation. 2021;7(4):258.

    Article  CAS  Google Scholar 

  29. Driehuis F, Wilkinson JM, Jiang Y, Ogunade I, Adesogan AT. Silage review: Animal and human health risks from silage. J Dairy Sci. 2018;101(5):4093–110.

    Article  PubMed  CAS  Google Scholar 

  30. McGarvey JA, Franco RB, Palumbo JD, Hnasko R, Stanker L, Mitloehner FM. Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air. J Appl Microbiol. 2013;114(6):1661–70.

    Article  PubMed  CAS  Google Scholar 

  31. Poduch E, Kotra LP. Acinetobacter infections. In: Enna SJ, Bylund DB, editors. xPharm: the comprehensive pharmacology reference. Elsevier: New York; 2007. p. 1–9.

    Google Scholar 

  32. Wang C, Sun L, Xu H, Na N, Yin G, Liu S, et al. Microbial communities, metabolites, fermentation quality and aerobic stability of whole-plant corn silage collected from family farms in desert steppe of North China. Processes. 2021;9(5):784.

    Article  CAS  Google Scholar 

  33. Hao W, Wang HL, Ning TT, Yang FY, Xu CC. Aerobic stability and effects of yeasts during deterioration of non-fermented and fermented total mixed ration with different moisture levels. Asian-Australas J Anim Sci. 2015;28(6):816–26.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  34. Duniere L, Xu S, Long J, Elekwachi C, Wang Y, Turkington K, et al. Bacterial and fungal core microbiomes associated with small grain silages during ensiling and aerobic spoilage. BMC Microbiol. 2017;17(1):50.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Pahlow G, Muck RE, Driehuis F, Elferink SJ, WHO, Spoelstra SF. Microbiology of ensiling. In: Silage science and technology. 2015. pp 31–93.

  36. Liu B, Huan H, Gu H, Xu N, Shen Q, Ding C. Dynamics of a microbial community during ensiling and upon aerobic exposure in lactic acid bacteria inoculation-treated and untreated barley silages. Bioresour Technol. 2019;273:212–9.

    Article  PubMed  CAS  Google Scholar 

  37. Bernardes TF, De Oliveira IL, Casagrande DR, Ferrero F, Tabacco E, Borreani G. Feed-out rate used as a tool to manage the aerobic deterioration of corn silages in tropical and temperate climates. J Dairy Sci. 2021;104(10):10828–40.

    Article  PubMed  CAS  Google Scholar 

  38. Ferrero F, Prencipe S, Spadaro D, Gullino ML, Cavallarin L, Piano S, et al. Increase in aflatoxins due to Aspergillus section Flavi multiplication during the aerobic deterioration of corn silage treated with different bacteria inocula. J Dairy Sci. 2019;102(2):1176–93.

    Article  PubMed  CAS  Google Scholar 

  39. Vandicke J, De Visschere K, Ameye M, Croubels S, De Saeger S, Audenaert K, et al. Multi-mycotoxin contamination of maize silages in Flanders, Belgium: monitoring mycotoxin levels from seed to feed. Toxins. 2021;13(3):202–23.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  40. Dogi CA, Fochesato A, Armando R, Pribull B, de Souza MM, da Silva CI, et al. Selection of lactic acid bacteria to promote an efficient silage fermentation capable of inhibiting the activity of Aspergillus parasiticus and Fusarium gramineraum and mycotoxin production. J Appl Microbiol. 2013;114(6):1650–60.

    Article  PubMed  CAS  Google Scholar 

  41. Keshri J, Chen Y, Pinto R, Kroupitski Y, Weinberg ZG, Sela Saldinger S. Microbiome dynamics during ensiling of corn with and without Lactobacillus plantarum inoculant. Appl Microbiol Biotechnol. 2018;102(9):4025–37.

    Article  PubMed  CAS  Google Scholar 

  42. Romero JJ, Park J, Joo Y, Zhao Y, Killerby M, Reyes DC, et al. A combination of Lactobacillus buchneri and Pediococcus pentosaceus extended the aerobic stability of conventional and brown midrib mutants-corn hybrids ensiled at low dry matter concentrations by causing a major shift in their bacterial and fungal community. J Anim Sci. 2021;99(8):1–16.

    Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

National Natural Science Foundation of China (31872421 and 32271773) and Tibetan Key R&D Program (XZ202001ZY0047N).

Author information

Authors and Affiliations

  1. Institute of Ensiling and Processing of Grass, College of Agro-Grassland Science, Nanjing Agricultural University, Nanjing, 210095, China

    Wenbo Wang, Xinyu Cai, Tao Shao, Wenkang Wang, Pengfei Ma, Junfeng Li, Jie Zhao & Xianjun Yuan

  2. Department of Animal Science, Food and Nutrition (DIANA), Faculty of Agricultural, Food and Environmental Sciences, Università Cattolica del Sacro Cuore, 29122, Piacenza, Italy

    Antonio Gallo

  3. Institute of Animal Science, Tibet Academy of Agriculture and Animal Husbandry Sciences, Lhasa, 850000, China

    Zhaxi Yangzong

Authors
  1. Wenbo Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Xinyu Cai
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Tao Shao
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Zhaxi Yangzong
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Wenkang Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Pengfei Ma
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Junfeng Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Jie Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Antonio Gallo
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Xianjun Yuan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

WbW, XC, WkW, and PM: performed the experiment, analysis, and writing. JL, JZ, and AG: performed the editing and revision. XY and TS: designed the experiment. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Xianjun Yuan.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors listed have read the complete manuscript and have approved the submission of the paper.

Competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Fig. S1.

The bacterial diversity indexes in non-fungal infection (left) and fungal infection (right) of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW. 0 d, after silo opening; 6 d, after 6 days of aerobic exposure; FW, fresh weight. Fig. S2. The fungal diversity indexes in non-fungal infection (left) and fungal infection (right) of corn silage during aerobic exposure. C, control; LB, L. buchneri applied at 1 × 106 cfu/g FW; LP, L. plantarum applied at 1 × 106 cfu/g FW; LBLP, L. buchneri and L. plantarum applied at 0.5 × 106 cfu/g FW. 0 d, after silo opening; 6 d, after 6 days of aerobic exposure; FW, fresh weight. Fig. S3. Principal coordinate analysis (PCoA) plot based on Unweighted-UniFrac dissimilarity distance of the bacterial (A) and fungal (B) community between samples. NFI, Non-fungal infection; FI, Fungal infection. C, Control of non-fungal infestation silages; LB, L. buchneri treatment of non-fungal infestation silages; LP, L. plantarum treatment of non-fungal infestation silages; LBLP, L. buchneri and L. plantarum treatment of non-fungal infestation silages. Fig. S4. Correlation analysis of the mycotoxins and fungal (10 most abundant genera) community compositions. *P < 0.05; **P < 0.01; ***P < 0.001. Table S1. The mycotoxin concentrations (μg/kg DM) of corn silages during aerobic exposure.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Wang, W., Cai, X., Shao, T. et al. Effects of bacterial inoculants on the microbial community, mycotoxin contamination, and aerobic stability of corn silage infected in the field by toxigenic fungi. Chem. Biol. Technol. Agric. 9, 93 (2022). https://doi.org/10.1186/s40538-022-00364-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40538-022-00364-6

Keywords

  • Lentilactobacillus buchneri
  • Lactiplantibacillus plantarum
  • Fungal infection
  • Mycotoxins